Incidental Mutation 'R2022:Hsd11b1'
ID224072
Institutional Source Beutler Lab
Gene Symbol Hsd11b1
Ensembl Gene ENSMUSG00000016194
Gene Namehydroxysteroid 11-beta dehydrogenase 1
Synonyms11beta-hydroxysteroid dehydrogenase type 1, 11beta-HSD-1
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R2022 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193221634-193264075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 193240378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 124 (T124A)
Ref Sequence ENSEMBL: ENSMUSP00000124693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016338] [ENSMUST00000159644] [ENSMUST00000160929] [ENSMUST00000161737] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably benign
Transcript: ENSMUST00000016338
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016338
Gene: ENSMUSG00000016194
AA Change: T124A

DomainStartEndE-ValueType
Pfam:adh_short 35 230 1.1e-53 PFAM
Pfam:KR 36 215 2.4e-9 PFAM
Pfam:adh_short_C2 41 248 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159644
AA Change: T124A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124693
Gene: ENSMUSG00000016194
AA Change: T124A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:adh_short 47 214 2.1e-32 PFAM
Pfam:KR 48 223 1.6e-10 PFAM
Pfam:adh_short_C2 53 221 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160929
AA Change: T94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123849
Gene: ENSMUSG00000016194
AA Change: T94A

DomainStartEndE-ValueType
Pfam:adh_short 5 172 1.5e-32 PFAM
Pfam:KR 6 184 8.2e-11 PFAM
Pfam:adh_short_C2 11 218 1.6e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161406
AA Change: T11A
SMART Domains Protein: ENSMUSP00000124142
Gene: ENSMUSG00000016194
AA Change: T11A

DomainStartEndE-ValueType
Pfam:adh_short 1 72 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161737
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125620
Gene: ENSMUSG00000016194
AA Change: T124A

DomainStartEndE-ValueType
Pfam:adh_short 35 202 2.6e-32 PFAM
Pfam:KR 36 216 1.7e-10 PFAM
Pfam:adh_short_C2 41 248 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162842
SMART Domains Protein: ENSMUSP00000124715
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 1 132 4.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191977
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194677
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display improved glucose tolerance and lower circulating lipid levels. Mice homozygous for a different targeted allele exhibit decreased susceptibility to weight gain, adiposis or hyperinsulinemia induced by 11-DHC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dym T C 18: 75,080,250 V181A probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Krt40 T A 11: 99,539,992 E285D probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Prom1 G T 5: 44,029,726 D396E probably benign Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tm9sf3 A G 19: 41,238,792 F280S probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Wdr66 G A 5: 123,273,790 G495D probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Hsd11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Hsd11b1 APN 1 193241458 start codon destroyed probably null 0.43
IGL00969:Hsd11b1 APN 1 193223644 nonsense probably null
IGL02068:Hsd11b1 APN 1 193222046 nonsense probably null
IGL02331:Hsd11b1 APN 1 193240616 missense probably damaging 1.00
H8786:Hsd11b1 UTSW 1 193240252 missense probably benign 0.30
R0207:Hsd11b1 UTSW 1 193240248 missense probably damaging 1.00
R0267:Hsd11b1 UTSW 1 193241397 missense probably damaging 1.00
R0334:Hsd11b1 UTSW 1 193242168 intron probably benign
R0591:Hsd11b1 UTSW 1 193229676 intron probably benign
R1244:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R1569:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1570:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1892:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R2021:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2023:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R5061:Hsd11b1 UTSW 1 193242245 missense probably benign
R5531:Hsd11b1 UTSW 1 193240249 frame shift probably null
R5768:Hsd11b1 UTSW 1 193240246 missense probably damaging 0.99
R5793:Hsd11b1 UTSW 1 193242184 missense probably damaging 1.00
R5795:Hsd11b1 UTSW 1 193240632 missense possibly damaging 0.85
R6359:Hsd11b1 UTSW 1 193242352 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAACTCGAACTTGTGCCCAG -3'
(R):5'- TCAAGGCGGGAAAGCTCATG -3'

Sequencing Primer
(F):5'- GAGTCCAGCATAGCCCTAGC -3'
(R):5'- AAAGCTCATGGGTAAGGCTTCCC -3'
Posted On2014-08-25