Mutagenetix > Incidental Mutations

Incidental Mutation 'R1994:Gria2'

224097

Institutional Source

Beutler Lab

Gene Symbol

Gria2

Ensembl Gene

ENSMUSG00000033981

Gene Name

glutamate receptor, ionotropic, AMPA2 (alpha 2)

Synonyms

Glur2, Glur-2, GluR-B, GluA2, GluR2

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R1994 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80681450-80802835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80802357 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 10 (L10F)

Ref Sequence

ENSEMBL: ENSMUSP00000141447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]

Predicted Effect

probably benign
Transcript: ENSMUST00000075316
AA Change: L10F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: L10F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	49	379	2.7e-58	PFAM
PBPe	415	790	3.75e-132	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107745
AA Change: L10F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: L10F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	47	379	4.8e-53	PFAM
PBPe	415	790	8.16e-133	SMART
Lig_chan-Glu_bd	425	490	2.96e-31	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	853	865	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192463
AA Change: L10F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: L10F

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	47	379	1.7e-51	PFAM
PBPe	415	770	1.2e-105	SMART
Lig_chan-Glu_bd	425	490	2.2e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194164

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195062

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,282,670		probably null	Het
Abcc8	T	G	7: 46,157,119	R388S	probably benign	Het
Abhd18	C	T	3: 40,934,926	R414*	probably null	Het
Acap1	C	T	11: 69,889,498	V40I	probably benign	Het
Actn1	C	A	12: 80,204,971	G111*	probably null	Het
Adam26b	T	C	8: 43,520,639	Q442R	probably benign	Het
Adamts19	T	C	18: 58,972,831		probably null	Het
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AI661453	A	G	17: 47,467,034		probably benign	Het
Ap4e1	T	C	2: 127,061,547	S790P	probably benign	Het
Asmt	A	G	X: 170,675,789	E168G	possibly damaging	Het
Atp2a3	T	A	11: 72,975,414	S287T	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Bicd1	A	T	6: 149,513,552	T588S	probably benign	Het
Birc6	T	G	17: 74,598,062	N1283K	probably benign	Het
Cacna1e	T	A	1: 154,477,817	Q423L	probably damaging	Het
Capn3	T	A	2: 120,495,937	Y537N	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Chgb	T	C	2: 132,786,498	S48P	possibly damaging	Het
Cidec	T	A	6: 113,428,232	Y159F	probably damaging	Het
Clec18a	T	C	8: 111,081,602	S66G	possibly damaging	Het
Cpsf1	G	A	15: 76,603,160	T138M	probably benign	Het
Dclre1c	C	T	2: 3,437,985	R61W	probably damaging	Het
Eef1akmt1	A	C	14: 57,550,454	V149G	probably benign	Het
Fam131b	T	C	6: 42,320,884	T112A	possibly damaging	Het
Fbln2	A	G	6: 91,234,301	E409G	probably damaging	Het
Fkbp15	G	A	4: 62,304,381	P1094S	probably benign	Het
Fpr1	A	G	17: 17,877,617	S37P	probably benign	Het
Fryl	G	T	5: 73,108,493	T495K	probably damaging	Het
Gja6	A	T	X: 160,903,378	I186N	possibly damaging	Het
Gm4922	T	C	10: 18,783,640	T445A	probably benign	Het
Gspt2	A	G	X: 94,637,419	D388G	possibly damaging	Het
Hdc	T	A	2: 126,616,187	I72F	probably damaging	Het
Igf2r	T	C	17: 12,692,738	K1905E	probably benign	Het
Il33	A	G	19: 29,956,904	D155G	possibly damaging	Het
Klk1b9	C	T	7: 43,979,555	T161I	probably benign	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Mgat5	A	T	1: 127,459,959	I551F	possibly damaging	Het
Miga2	A	T	2: 30,381,988	D25V	probably damaging	Het
Mlc1	T	C	15: 88,974,579	N122S	possibly damaging	Het
Mmp20	T	A	9: 7,645,292	M281K	probably benign	Het
Muc5ac	C	A	7: 141,813,152	P2232T	possibly damaging	Het
N4bp2l2	A	G	5: 150,661,283	S411P	possibly damaging	Het
Ngef	G	A	1: 87,487,904	S346L	probably damaging	Het
Nov	T	A	15: 54,749,354	V253E	probably benign	Het
Olfr1217	T	A	2: 89,023,143	T287S	probably damaging	Het
Olfr1309	T	A	2: 111,984,084	M5L	probably benign	Het
Olfr1408	C	T	1: 173,130,851	R122H	possibly damaging	Het
Olfr553	C	T	7: 102,614,540	V150M	probably damaging	Het
Olfr612	T	C	7: 103,538,359	I292V	possibly damaging	Het
Olfr661	T	C	7: 104,688,483	I156T	probably benign	Het
Olfr720	A	G	14: 14,175,854	I76T	probably benign	Het
Olfr782	T	A	10: 129,350,692	I43N	probably damaging	Het
Olfr811	T	C	10: 129,801,661	Y288C	probably damaging	Het
Papd5	C	T	8: 88,246,484	T277M	probably damaging	Het
Pecam1	G	T	11: 106,695,937	H150N	possibly damaging	Het
Polr3c	A	T	3: 96,714,373		probably null	Het
Pop1	A	C	15: 34,530,471	Q1005P	probably damaging	Het
Prss22	G	A	17: 23,996,314	P163S	probably damaging	Het
Prss33	G	A	17: 23,834,198	A223V	probably damaging	Het
Prss53	C	T	7: 127,887,393	V354I	probably benign	Het
Rab3gap2	C	T	1: 185,236,024	T191I	probably damaging	Het
Rictor	T	C	15: 6,776,156	F608L	probably benign	Het
Ryr3	T	A	2: 112,654,492	E3884V	probably null	Het
Scaf11	G	A	15: 96,418,840	R948*	probably null	Het
Sec61g	A	T	11: 16,506,444	V40E	probably damaging	Het
Serpinb3d	A	T	1: 107,080,788	F116I	possibly damaging	Het
Sipa1l3	T	C	7: 29,399,611	D411G	probably benign	Het
Slc13a3	T	C	2: 165,434,064	N254S	possibly damaging	Het
Slc35a2	T	A	X: 7,892,825	L110Q	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Spsb2	T	C	6: 124,809,366		probably null	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Traf7	A	G	17: 24,510,502	V445A	probably damaging	Het
Trib1	A	G	15: 59,649,343	S61G	possibly damaging	Het
Trip12	A	T	1: 84,749,172	F36I	probably damaging	Het
Tshz3	T	C	7: 36,769,822	I412T	probably damaging	Het
Tsku	T	C	7: 98,352,146	Y326C	probably damaging	Het
Ttc30b	A	G	2: 75,938,058	L117P	probably damaging	Het
Ttn	T	G	2: 76,881,694		probably benign	Het
Ugt1a6a	G	A	1: 88,138,748	R92H	probably benign	Het
Vmn1r63	A	G	7: 5,803,255	V126A	probably benign	Het
Vmn2r84	T	A	10: 130,386,009	S781C	probably damaging	Het
Wdr91	T	A	6: 34,892,362	H409L	probably damaging	Het
Wnt7a	T	A	6: 91,365,956	T315S	possibly damaging	Het
Zdhhc25	A	G	15: 88,600,824	T121A	probably benign	Het
Zfp109	T	C	7: 24,229,318	H222R	probably benign	Het
Zfp286	A	G	11: 62,779,820	S476P	probably damaging	Het
Zfp605	T	C	5: 110,127,552	Y179H	probably damaging	Het
Zfp955a	T	C	17: 33,241,646	H504R	probably damaging	Het
Zswim2	T	A	2: 83,915,663	N477I	possibly damaging	Het

Other mutations in Gria2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Gria2	APN	3	80710790	missense	probably benign	0.12
IGL00832:Gria2	APN	3	80707251	missense	probably damaging	1.00
IGL01086:Gria2	APN	3	80692381	missense	probably damaging	1.00
IGL01409:Gria2	APN	3	80707697	critical splice donor site	probably null
IGL01924:Gria2	APN	3	80710331	missense	probably benign	0.13
IGL01999:Gria2	APN	3	80732091	missense	probably damaging	1.00
IGL02355:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02362:Gria2	APN	3	80706937	missense	probably damaging	1.00
IGL02389:Gria2	APN	3	80709422	missense	probably benign	0.14
IGL02444:Gria2	APN	3	80702553	missense	possibly damaging	0.65
IGL02532:Gria2	APN	3	80706999	missense	probably damaging	1.00
IGL02991:Gria2	UTSW	3	80707809	nonsense	probably null
R0015:Gria2	UTSW	3	80707767	missense	probably damaging	1.00
R0148:Gria2	UTSW	3	80707731	missense	probably damaging	1.00
R0201:Gria2	UTSW	3	80707838	missense	probably damaging	1.00
R0411:Gria2	UTSW	3	80710858	splice site	probably benign
R0551:Gria2	UTSW	3	80732026	splice site	probably benign
R0655:Gria2	UTSW	3	80732070	nonsense	probably null
R0866:Gria2	UTSW	3	80722024	splice site	probably benign
R1393:Gria2	UTSW	3	80707098	missense	probably damaging	1.00
R1458:Gria2	UTSW	3	80732045	missense	possibly damaging	0.71
R1563:Gria2	UTSW	3	80691397	missense	probably damaging	0.96
R1771:Gria2	UTSW	3	80692301	nonsense	probably null
R1775:Gria2	UTSW	3	80691338	missense	probably benign	0.09
R1902:Gria2	UTSW	3	80722108	missense	probably damaging	0.98
R1993:Gria2	UTSW	3	80802357	missense	probably benign
R1995:Gria2	UTSW	3	80802357	missense	probably benign
R2001:Gria2	UTSW	3	80710805	missense	probably benign	0.28
R2389:Gria2	UTSW	3	80702625	missense	probably damaging	1.00
R2520:Gria2	UTSW	3	80706962	missense	probably damaging	1.00
R2679:Gria2	UTSW	3	80740953	splice site	probably benign
R2865:Gria2	UTSW	3	80732085	missense	probably benign	0.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2869:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2870:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2871:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R2872:Gria2	UTSW	3	80702492	missense	probably damaging	1.00
R3716:Gria2	UTSW	3	80741004	missense	possibly damaging	0.77
R3967:Gria2	UTSW	3	80710777	missense	possibly damaging	0.95
R4285:Gria2	UTSW	3	80707662	intron	probably benign
R4611:Gria2	UTSW	3	80692492	missense	probably damaging	0.99
R4612:Gria2	UTSW	3	80732051	missense	probably damaging	1.00
R4616:Gria2	UTSW	3	80706897	missense	probably damaging	1.00
R4706:Gria2	UTSW	3	80740990	missense	probably benign
R4996:Gria2	UTSW	3	80707141	missense	probably damaging	0.99
R5502:Gria2	UTSW	3	80706945	missense	probably damaging	1.00
R5930:Gria2	UTSW	3	80707249	missense	possibly damaging	0.91
R6142:Gria2	UTSW	3	80801717	missense	probably benign	0.13
R6233:Gria2	UTSW	3	80707203	missense	probably damaging	0.99
R6317:Gria2	UTSW	3	80741004	missense	possibly damaging	0.79
R6453:Gria2	UTSW	3	80740974	missense	possibly damaging	0.93
R6526:Gria2	UTSW	3	80692469	missense	probably damaging	1.00
R6545:Gria2	UTSW	3	80741144	missense	probably damaging	0.99
R6574:Gria2	UTSW	3	80689296	missense	probably damaging	0.99
R6720:Gria2	UTSW	3	80802304	missense	probably benign	0.37
R7009:Gria2	UTSW	3	80706972	missense	probably damaging	1.00
R7049:Gria2	UTSW	3	80689327	missense	probably damaging	0.99
R7191:Gria2	UTSW	3	80732085	missense	probably benign	0.24
R7225:Gria2	UTSW	3	80802631	unclassified	probably benign
R7374:Gria2	UTSW	3	80741076	missense	probably benign
R7837:Gria2	UTSW	3	80710788	missense	probably benign	0.18
R8034:Gria2	UTSW	3	80801699	missense	probably damaging	1.00
R8125:Gria2	UTSW	3	80707243	missense	possibly damaging	0.88
R8189:Gria2	UTSW	3	80722182	missense	probably damaging	1.00
R8209:Gria2	UTSW	3	80709457	missense	probably benign	0.01
R8362:Gria2	UTSW	3	80707890	missense	possibly damaging	0.82
R8481:Gria2	UTSW	3	80801691	missense	possibly damaging	0.95
R8500:Gria2	UTSW	3	80692467	missense	probably damaging	0.99
R8516:Gria2	UTSW	3	80706987	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TCCCCTCTATTGTGTCAAAAGGC -3'
(R):5'- CTTCGTGGTTTTAGCAGCTC -3'

Sequencing Primer
(F):5'- GTTTCAATCTGGAATGCAGTCAAGG -3'
(R):5'- CCTTGCTAAATTTCGACCTCAAAATG -3'

Posted On

2014-08-25