Incidental Mutation 'R1994:Fryl'
ID 224102
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 2510002A14Rik, 2310004H21Rik, 9030227G01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock # R1994 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 73019987-73256619 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73108493 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 495 (T495K)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127] [ENSMUST00000153903]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: T495K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: T495K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: T495K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: T495K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153903
SMART Domains Protein: ENSMUSP00000119385
Gene: ENSMUSG00000070733

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 1 199 4.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153923
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,282,670 probably null Het
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Cidec T A 6: 113,428,232 Y159F probably damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fbln2 A G 6: 91,234,301 E409G probably damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Klk1b9 C T 7: 43,979,555 T161I probably benign Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Rictor T C 15: 6,776,156 F608L probably benign Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc35a2 T A X: 7,892,825 L110Q probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 splice site probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
R7917:Fryl UTSW 5 73054532 missense probably damaging 1.00
R7920:Fryl UTSW 5 73101807 splice site probably null
R8110:Fryl UTSW 5 73133277 missense probably benign 0.10
R8120:Fryl UTSW 5 73071184 missense probably benign 0.01
R8143:Fryl UTSW 5 73050339 missense probably benign 0.00
R8207:Fryl UTSW 5 73100500 splice site probably null
R8263:Fryl UTSW 5 73081005 missense probably damaging 1.00
R8350:Fryl UTSW 5 73068730 missense probably benign
R8359:Fryl UTSW 5 73075933 missense probably benign 0.39
R8387:Fryl UTSW 5 73136320 critical splice donor site probably null
R8403:Fryl UTSW 5 73118447 makesense probably null
R8450:Fryl UTSW 5 73068730 missense probably benign
R8514:Fryl UTSW 5 73085356 missense probably benign
R8536:Fryl UTSW 5 73100353 missense probably damaging 0.99
R8703:Fryl UTSW 5 73090654 missense probably damaging 0.99
R8708:Fryl UTSW 5 73132562 missense probably benign 0.01
R8783:Fryl UTSW 5 73068842 missense probably benign 0.45
R9028:Fryl UTSW 5 73098266 missense probably benign 0.18
R9045:Fryl UTSW 5 73024775 missense
R9063:Fryl UTSW 5 73081003 missense possibly damaging 0.70
R9096:Fryl UTSW 5 73108577 missense probably benign 0.01
R9345:Fryl UTSW 5 73050411 missense probably benign
R9381:Fryl UTSW 5 73083294 missense probably benign 0.24
R9386:Fryl UTSW 5 73191809 missense unknown
R9401:Fryl UTSW 5 73065220 nonsense probably null
R9497:Fryl UTSW 5 73057791 missense
R9514:Fryl UTSW 5 73104772 missense probably damaging 1.00
R9570:Fryl UTSW 5 73022155 missense probably benign 0.02
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCTACTGCGTACAAATTG -3'
(R):5'- TTAGCCTAGGCAGTGCTTGG -3'

Sequencing Primer
(F):5'- GGCTACTGCGTACAAATTGCACAG -3'
(R):5'- CAGTGCTTGGCCCTGATC -3'
Posted On 2014-08-25