Incidental Mutation 'R2022:Prom1'
ID224107
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Nameprominin 1
Synonyms4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R2022 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43993620-44102032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44029726 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 396 (D396E)
Ref Sequence ENSEMBL: ENSMUSP00000137557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030973] [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000087442] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000177946] [ENSMUST00000179059] [ENSMUST00000197706] [ENSMUST00000197750]
Predicted Effect probably benign
Transcript: ENSMUST00000030973
AA Change: D362E

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030973
Gene: ENSMUSG00000029086
AA Change: D362E

DomainStartEndE-ValueType
Pfam:Prominin 11 326 1.5e-113 PFAM
Pfam:Prominin 322 798 4.6e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074113
AA Change: D396E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086
AA Change: D396E

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087441
AA Change: D387E

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086
AA Change: D387E

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087442
AA Change: D387E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084709
Gene: ENSMUSG00000029086
AA Change: D387E

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
AA Change: D387E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086
AA Change: D387E

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
AA Change: D396E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086
AA Change: D396E

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177946
AA Change: D387E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136483
Gene: ENSMUSG00000029086
AA Change: D387E

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179059
AA Change: D396E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137557
Gene: ENSMUSG00000029086
AA Change: D396E

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196853
Predicted Effect probably benign
Transcript: ENSMUST00000197706
AA Change: D357E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142632
Gene: ENSMUSG00000029086
AA Change: D357E

DomainStartEndE-ValueType
Pfam:Prominin 11 321 6.6e-110 PFAM
Pfam:Prominin 317 793 6.8e-188 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197749
Predicted Effect probably benign
Transcript: ENSMUST00000197750
AA Change: D387E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086
AA Change: D387E

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000198347
AA Change: T189K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199739
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dym T C 18: 75,080,250 V181A probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Krt40 T A 11: 99,539,992 E285D probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tm9sf3 A G 19: 41,238,792 F280S probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Wdr66 G A 5: 123,273,790 G495D probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
BB001:Prom1 UTSW 5 44029769 missense probably benign 0.03
BB011:Prom1 UTSW 5 44029769 missense probably benign 0.03
R1018:Prom1 UTSW 5 44029714 missense probably benign 0.02
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1536:Prom1 UTSW 5 44018353 missense probably benign 0.39
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4909:Prom1 UTSW 5 44045552 missense probably benign 0.00
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 splice site probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5537:Prom1 UTSW 5 44000776 critical splice donor site probably null
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6542:Prom1 UTSW 5 44037509 missense possibly damaging 0.84
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
R7158:Prom1 UTSW 5 44012913 missense probably damaging 1.00
R7233:Prom1 UTSW 5 44037474 missense possibly damaging 0.90
R7244:Prom1 UTSW 5 44020900 missense probably benign 0.03
R7339:Prom1 UTSW 5 44101653 unclassified probably benign
R7365:Prom1 UTSW 5 44020831 missense probably damaging 1.00
R7573:Prom1 UTSW 5 44055930 missense probably damaging 0.99
R7592:Prom1 UTSW 5 44063127 missense probably damaging 0.96
R7809:Prom1 UTSW 5 44020867 missense probably benign 0.10
R7915:Prom1 UTSW 5 44004935 missense possibly damaging 0.88
R7924:Prom1 UTSW 5 44029769 missense probably benign 0.03
R8122:Prom1 UTSW 5 44012953 missense probably benign 0.12
R8187:Prom1 UTSW 5 44034366 missense probably damaging 1.00
R8195:Prom1 UTSW 5 44037428 missense possibly damaging 0.69
R8516:Prom1 UTSW 5 44007099 missense probably benign 0.05
R8529:Prom1 UTSW 5 44013027 splice site probably null
R8670:Prom1 UTSW 5 44001844 missense probably benign 0.00
R8835:Prom1 UTSW 5 44018380 missense probably damaging 1.00
R8907:Prom1 UTSW 5 44001793 missense probably damaging 1.00
Z1177:Prom1 UTSW 5 44014838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCACTTGACTCCATAAGG -3'
(R):5'- GGCTTGACTTCAGTACCATCTC -3'

Sequencing Primer
(F):5'- CCACTTGACTCCATAAGGTTATTGTG -3'
(R):5'- CACTAATTCTGTGCTTAGATTCACTG -3'
Posted On2014-08-25