Incidental Mutation 'R2022:Wdr66'
ID224113
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2022 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123273790 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 495 (G495D)
Ref Sequence ENSEMBL: ENSMUSP00000113309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121964] [ENSMUST00000163092] [ENSMUST00000170536]
Predicted Effect probably benign
Transcript: ENSMUST00000121964
AA Change: G495D

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442
AA Change: G495D

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143629
Predicted Effect probably benign
Transcript: ENSMUST00000163092
SMART Domains Protein: ENSMUSP00000126995
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
Blast:WD40 1 28 3e-10 BLAST
Blast:WD40 35 75 2e-15 BLAST
Blast:WD40 87 126 3e-17 BLAST
low complexity region 130 144 N/A INTRINSIC
WD40 146 180 7.64e1 SMART
Blast:WD40 183 246 2e-14 BLAST
WD40 248 287 8.62e-4 SMART
WD40 292 330 1.19e1 SMART
WD40 335 374 5.97e-1 SMART
WD40 383 426 1.23e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170536
AA Change: G56D

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129769
Gene: ENSMUSG00000029442
AA Change: G56D

DomainStartEndE-ValueType
WD40 42 86 3.18e1 SMART
Blast:WD40 93 133 1e-15 BLAST
Blast:WD40 145 184 3e-17 BLAST
low complexity region 188 202 N/A INTRINSIC
WD40 204 238 7.64e1 SMART
Blast:WD40 241 304 3e-14 BLAST
WD40 306 345 8.62e-4 SMART
WD40 350 388 1.19e1 SMART
WD40 393 432 5.97e-1 SMART
WD40 441 484 1.23e2 SMART
Blast:WD40 490 535 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200666
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dym T C 18: 75,080,250 V181A probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Krt40 T A 11: 99,539,992 E285D probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Prom1 G T 5: 44,029,726 D396E probably benign Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tm9sf3 A G 19: 41,238,792 F280S probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7967:Wdr66 UTSW 5 123283516 missense possibly damaging 0.89
R8004:Wdr66 UTSW 5 123254450 missense unknown
R8068:Wdr66 UTSW 5 123256166 missense not run
R8141:Wdr66 UTSW 5 123286430 missense possibly damaging 0.83
R8222:Wdr66 UTSW 5 123302423 missense probably damaging 1.00
R8242:Wdr66 UTSW 5 123273851 missense possibly damaging 0.89
R8303:Wdr66 UTSW 5 123322587 missense probably damaging 0.99
R8323:Wdr66 UTSW 5 123297525 missense probably benign 0.16
R8773:Wdr66 UTSW 5 123273850 missense probably benign 0.12
R8869:Wdr66 UTSW 5 123322442 missense possibly damaging 0.48
R8881:Wdr66 UTSW 5 123324375 missense probably damaging 1.00
R8921:Wdr66 UTSW 5 123286418 missense possibly damaging 0.71
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123254242 small insertion probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCATCTCCCCTCTTTGCAG -3'
(R):5'- GGACCCAAGCCAATACTGTG -3'

Sequencing Primer
(F):5'- GTAACCCTAGCTTCATGGGATCG -3'
(R):5'- CAAGCCAATACTGTGATGTCTGC -3'
Posted On2014-08-25