Incidental Mutation 'R1994:Fbln2'
ID224118
Institutional Source Beutler Lab
Gene Symbol Fbln2
Ensembl Gene ENSMUSG00000064080
Gene Namefibulin 2
Synonyms5730577E14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1994 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91212455-91272540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91234301 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 409 (E409G)
Ref Sequence ENSEMBL: ENSMUSP00000109126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041544] [ENSMUST00000113498] [ENSMUST00000132021] [ENSMUST00000134974] [ENSMUST00000153364]
Predicted Effect probably damaging
Transcript: ENSMUST00000041544
AA Change: E409G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048334
Gene: ENSMUSG00000064080
AA Change: E409G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF 712 755 1.33e1 SMART
EGF_CA 756 800 1.34e-6 SMART
EGF_CA 801 846 1.65e-6 SMART
EGF_CA 847 894 2.06e-7 SMART
EGF_CA 895 937 3.56e-11 SMART
EGF_CA 938 979 3.48e-14 SMART
EGF_CA 980 1018 1.7e-8 SMART
EGF_CA 1019 1061 8.18e-11 SMART
EGF_CA 1062 1106 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113498
AA Change: E409G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109126
Gene: ENSMUSG00000064080
AA Change: E409G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF_CA 709 753 1.34e-6 SMART
EGF_CA 754 799 1.65e-6 SMART
EGF_CA 800 847 2.06e-7 SMART
EGF_CA 848 890 3.56e-11 SMART
EGF_CA 891 932 3.48e-14 SMART
EGF_CA 933 971 1.7e-8 SMART
EGF_CA 972 1014 8.18e-11 SMART
EGF_CA 1015 1059 5.08e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132021
SMART Domains Protein: ENSMUSP00000116456
Gene: ENSMUSG00000064080

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134974
SMART Domains Protein: ENSMUSP00000116302
Gene: ENSMUSG00000064080

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153364
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein, which belongs to the fibulin family. This protein binds various extracellular ligands and calcium. It may play a role during organ development, in particular, during the differentiation of heart, skeletal and neuronal structures. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alle are viable, fertile and grossly normal with no apparent defects in elastic fiber formation in the aorta and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,282,670 probably null Het
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Cidec T A 6: 113,428,232 Y159F probably damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Klk1b9 C T 7: 43,979,555 T161I probably benign Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Rictor T C 15: 6,776,156 F608L probably benign Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc35a2 T A X: 7,892,825 L110Q probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Fbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Fbln2 APN 6 91266392 missense probably damaging 1.00
IGL01664:Fbln2 APN 6 91233457 missense probably damaging 0.96
IGL02110:Fbln2 APN 6 91234102 missense probably benign 0.01
IGL02227:Fbln2 APN 6 91256367 missense possibly damaging 0.90
IGL02814:Fbln2 APN 6 91265857 nonsense probably null
IGL03287:Fbln2 APN 6 91233494 missense probably damaging 1.00
IGL03412:Fbln2 APN 6 91271781 missense probably damaging 1.00
IGL03014:Fbln2 UTSW 6 91265919 intron probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R1563:Fbln2 UTSW 6 91263383 nonsense probably null
R1843:Fbln2 UTSW 6 91265775 missense probably damaging 1.00
R1846:Fbln2 UTSW 6 91256417 missense possibly damaging 0.91
R2431:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R2443:Fbln2 UTSW 6 91259711 missense probably damaging 1.00
R2925:Fbln2 UTSW 6 91265855 missense probably damaging 1.00
R3030:Fbln2 UTSW 6 91233715 missense probably damaging 1.00
R3758:Fbln2 UTSW 6 91256381 missense probably damaging 1.00
R3854:Fbln2 UTSW 6 91266371 missense probably damaging 1.00
R4006:Fbln2 UTSW 6 91269961 splice site probably null
R4627:Fbln2 UTSW 6 91259767 missense probably damaging 1.00
R4752:Fbln2 UTSW 6 91256243 missense probably benign
R4763:Fbln2 UTSW 6 91270000 missense probably damaging 1.00
R4798:Fbln2 UTSW 6 91269186 missense probably benign 0.03
R4877:Fbln2 UTSW 6 91233495 missense probably damaging 1.00
R4878:Fbln2 UTSW 6 91256995 critical splice donor site probably null
R4937:Fbln2 UTSW 6 91264699 missense probably damaging 0.99
R4969:Fbln2 UTSW 6 91271587 missense possibly damaging 0.64
R4996:Fbln2 UTSW 6 91266010 missense probably benign 0.05
R5344:Fbln2 UTSW 6 91266383 missense probably damaging 1.00
R5681:Fbln2 UTSW 6 91271796 missense probably damaging 1.00
R5838:Fbln2 UTSW 6 91271848 missense possibly damaging 0.55
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6288:Fbln2 UTSW 6 91233281 missense probably damaging 1.00
R6433:Fbln2 UTSW 6 91233272 missense probably damaging 1.00
R6451:Fbln2 UTSW 6 91234259 missense probably benign 0.18
R6491:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6520:Fbln2 UTSW 6 91259659 missense probably damaging 1.00
R6657:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6987:Fbln2 UTSW 6 91234229 missense probably benign 0.00
R7344:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R7485:Fbln2 UTSW 6 91270161 intron probably null
R7488:Fbln2 UTSW 6 91265863 critical splice donor site probably null
R7571:Fbln2 UTSW 6 91268575 missense probably damaging 1.00
R7667:Fbln2 UTSW 6 91233667 missense probably damaging 1.00
R7776:Fbln2 UTSW 6 91269199 missense probably damaging 1.00
R7779:Fbln2 UTSW 6 91233194 missense probably damaging 1.00
Z1088:Fbln2 UTSW 6 91233346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCCTCGAAGTGTCATGC -3'
(R):5'- CTCGGACCACTTTGTCTCAG -3'

Sequencing Primer
(F):5'- TCCTCGAAGTGTCATGCAGGAG -3'
(R):5'- GACCACTTTGTCTCAGGCCTG -3'
Posted On2014-08-25