Incidental Mutation 'R1994:Cidec'
ID224123
Institutional Source Beutler Lab
Gene Symbol Cidec
Ensembl Gene ENSMUSG00000030278
Gene Namecell death-inducing DFFA-like effector c
SynonymsCIDE-3alpha, CIDE-3, Fsp27
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1994 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113424634-113435760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113428232 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 159 (Y159F)
Ref Sequence ENSEMBL: ENSMUSP00000108714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032416] [ENSMUST00000113089] [ENSMUST00000113091] [ENSMUST00000133348]
Predicted Effect probably damaging
Transcript: ENSMUST00000032416
AA Change: Y149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032416
Gene: ENSMUSG00000030278
AA Change: Y149F

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
CAD 43 116 7.93e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113089
AA Change: Y149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108712
Gene: ENSMUSG00000030278
AA Change: Y149F

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
CAD 43 116 7.93e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113091
AA Change: Y159F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108714
Gene: ENSMUSG00000030278
AA Change: Y159F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CAD 53 126 7.93e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133348
SMART Domains Protein: ENSMUSP00000122068
Gene: ENSMUSG00000030278

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:CIDE-N 41 83 2.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Nullizygous mice exhibit leaness, high energy expenditure, improved glucose tolerance, altered brown adipocytes, and multilocular fat droplets with enhanced mitochondrial activity and lipolysis in white adipocytes, and may show resistance to age related and diet-induced obesity and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,282,670 probably null Het
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fbln2 A G 6: 91,234,301 E409G probably damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Klk1b9 C T 7: 43,979,555 T161I probably benign Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Rictor T C 15: 6,776,156 F608L probably benign Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc35a2 T A X: 7,892,825 L110Q probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Cidec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03261:Cidec APN 6 113433172 missense probably benign 0.13
murre UTSW 6 113428398 missense probably benign
R2079:Cidec UTSW 6 113425654 missense probably benign 0.00
R3121:Cidec UTSW 6 113428125 missense probably benign
R4560:Cidec UTSW 6 113428438 missense probably damaging 1.00
R4775:Cidec UTSW 6 113434734 start codon destroyed probably null 0.53
R5513:Cidec UTSW 6 113428179 missense probably damaging 1.00
R5906:Cidec UTSW 6 113428321 splice site probably null
R7287:Cidec UTSW 6 113428398 missense probably benign
R7702:Cidec UTSW 6 113434454 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAGGCCTCTTGTCTTAGCG -3'
(R):5'- CCCTGGCAAAAGATACCATGTTC -3'

Sequencing Primer
(F):5'- AGCGTTTCTCCCAACCGG -3'
(R):5'- CCATGTTCATGGTCCTGCTGAAG -3'
Posted On2014-08-25