Incidental Mutation 'R0143:Zdbf2'
ID 22414
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 038428-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R0143 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 63273265-63314576 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63308074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1871 (I1871F)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect probably benign
Transcript: ENSMUST00000029025
AA Change: I1871F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: I1871F

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114132
AA Change: I1871F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: I1871F

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63304171 missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63306101 missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63306413 missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63304066 missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63305983 missense probably benign
R8306:Zdbf2 UTSW 1 63304075 missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63304976 missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63306007 missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63309570 small deletion probably benign
R8528:Zdbf2 UTSW 1 63303386 missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63308113 missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63308003 missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63307137 missense
R9072:Zdbf2 UTSW 1 63305764 missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63308009 missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63306241 missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63304129 missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63305625 missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63303377 missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63303476 missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- GATTCGCCAAACAGCTTTGAACTCC -3'
(R):5'- AGAAGTCACCTGCCCATGTTGC -3'

Sequencing Primer
(F):5'- ACTCCTGTGGATCTGAGCTAAAC -3'
(R):5'- ATGTTGCTGATGAAGCCCC -3'
Posted On 2013-04-16