Incidental Mutation 'R1994:Klk1b9'
ID224141
Institutional Source Beutler Lab
Gene Symbol Klk1b9
Ensembl Gene ENSMUSG00000059042
Gene Namekallikrein 1-related peptidase b9
SynonymsKlk9, Egfbp3, mGk-9, Egfbp-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1994 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43976061-43980376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43979555 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 161 (T161I)
Ref Sequence ENSEMBL: ENSMUSP00000080133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081399]
Predicted Effect probably benign
Transcript: ENSMUST00000081399
AA Change: T161I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080133
Gene: ENSMUSG00000059042
AA Change: T161I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206787
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,282,670 probably null Het
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Cidec T A 6: 113,428,232 Y159F probably damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fbln2 A G 6: 91,234,301 E409G probably damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Rictor T C 15: 6,776,156 F608L probably benign Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc35a2 T A X: 7,892,825 L110Q probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Klk1b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Klk1b9 APN 7 43978454 missense probably damaging 1.00
IGL01330:Klk1b9 APN 7 43978443 nonsense probably null
IGL03329:Klk1b9 APN 7 43979414 missense probably benign 0.00
R0206:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0208:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0632:Klk1b9 UTSW 7 43979372 missense possibly damaging 0.56
R1289:Klk1b9 UTSW 7 43978424 missense probably benign
R1437:Klk1b9 UTSW 7 43979690 missense probably damaging 1.00
R5006:Klk1b9 UTSW 7 43979287 nonsense probably null
R6572:Klk1b9 UTSW 7 43979735 missense probably benign
R7149:Klk1b9 UTSW 7 43979417 missense probably benign 0.30
R7726:Klk1b9 UTSW 7 43978416 missense possibly damaging 0.47
R7911:Klk1b9 UTSW 7 43979787 missense probably damaging 1.00
R7992:Klk1b9 UTSW 7 43979787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAAGCTTCCTTCACCCTG -3'
(R):5'- GCACACAGCATGACATCTGTC -3'

Sequencing Primer
(F):5'- TGGCTACAACAGGAGCCTC -3'
(R):5'- GACATCTGTCACCTTCTCTATGTGGG -3'
Posted On2014-08-25