Incidental Mutation 'R0143:B3galt2'
ID22416
Institutional Source Beutler Lab
Gene Symbol B3galt2
Ensembl Gene ENSMUSG00000033849
Gene NameUDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location143640664-143654614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143647334 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 403 (N403Y)
Ref Sequence ENSEMBL: ENSMUSP00000046118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337] [ENSMUST00000038252]
Predicted Effect probably benign
Transcript: ENSMUST00000018337
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000038252
AA Change: N403Y

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046118
Gene: ENSMUSG00000033849
AA Change: N403Y

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 165 359 3.8e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189597
Meta Mutation Damage Score 0.1142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene encodes a protein that functions in N-linked glycoprotein glycosylation and shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted mutation display hyperactivity, impaired motor coordination, decreased anxiety, increased startle reflexes, and decreased coping response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in B3galt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:B3galt2 APN 1 143647155 missense probably damaging 1.00
IGL01019:B3galt2 APN 1 143646757 missense probably benign 0.00
IGL01406:B3galt2 APN 1 143647106 missense possibly damaging 0.91
IGL01736:B3galt2 APN 1 143646845 missense probably benign 0.00
IGL02427:B3galt2 APN 1 143646516 missense probably benign
IGL03289:B3galt2 APN 1 143647304 missense probably damaging 1.00
R0620:B3galt2 UTSW 1 143646140 missense probably damaging 1.00
R0665:B3galt2 UTSW 1 143646453 missense possibly damaging 0.64
R1765:B3galt2 UTSW 1 143646469 missense probably benign 0.03
R2325:B3galt2 UTSW 1 143647188 missense probably benign 0.01
R3817:B3galt2 UTSW 1 143647073 missense probably damaging 1.00
R5248:B3galt2 UTSW 1 143647111 missense probably benign 0.01
R5863:B3galt2 UTSW 1 143646366 missense probably benign 0.36
R6339:B3galt2 UTSW 1 143646902 missense possibly damaging 0.49
R6419:B3galt2 UTSW 1 143647101 missense possibly damaging 0.48
R7529:B3galt2 UTSW 1 143646536 missense probably benign 0.01
R7577:B3galt2 UTSW 1 143647304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGAGAGTTGATCCTGTGCCCC -3'
(R):5'- ATGAGAATTGCATTGCTCAAACACCTG -3'

Sequencing Primer
(F):5'- TGCCCCCTCCCAATGAG -3'
(R):5'- GGTCCCTAATGTAAGTCTTGAACC -3'
Posted On2013-04-16