Incidental Mutation 'R2022:Krt40'
ID224182
Institutional Source Beutler Lab
Gene Symbol Krt40
Ensembl Gene ENSMUSG00000059169
Gene Namekeratin 40
SynonymsKa36
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2022 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99537485-99543158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99539992 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 285 (E285D)
Ref Sequence ENSEMBL: ENSMUSP00000073869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074253] [ENSMUST00000107443]
Predicted Effect probably damaging
Transcript: ENSMUST00000074253
AA Change: E285D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073869
Gene: ENSMUSG00000059169
AA Change: E285D

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Filament 88 399 1.07e-139 SMART
internal_repeat_1 409 419 9.76e-5 PROSPERO
internal_repeat_1 417 427 9.76e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000107443
AA Change: E205D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103067
Gene: ENSMUSG00000059169
AA Change: E205D

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Filament 88 149 4.8e-19 PFAM
Pfam:Filament 146 319 6.1e-50 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dym T C 18: 75,080,250 V181A probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Prom1 G T 5: 44,029,726 D396E probably benign Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tm9sf3 A G 19: 41,238,792 F280S probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Wdr66 G A 5: 123,273,790 G495D probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Krt40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Krt40 APN 11 99541219 missense probably damaging 1.00
IGL01483:Krt40 APN 11 99542727 missense probably damaging 1.00
IGL01621:Krt40 APN 11 99542868 missense probably damaging 1.00
IGL01921:Krt40 APN 11 99543163 unclassified probably benign
IGL02095:Krt40 APN 11 99541671 missense probably damaging 0.98
IGL02735:Krt40 APN 11 99538635 missense probably damaging 1.00
IGL02960:Krt40 APN 11 99539867 splice site probably null
IGL02965:Krt40 APN 11 99541666 missense probably damaging 1.00
IGL03168:Krt40 APN 11 99543028 missense possibly damaging 0.87
IGL03240:Krt40 APN 11 99537568 missense probably damaging 1.00
IGL03387:Krt40 APN 11 99539885 missense probably damaging 1.00
R0178:Krt40 UTSW 11 99541739 missense probably damaging 0.99
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0389:Krt40 UTSW 11 99541714 nonsense probably null
R1104:Krt40 UTSW 11 99540233 missense probably damaging 1.00
R2018:Krt40 UTSW 11 99540087 missense probably damaging 1.00
R4498:Krt40 UTSW 11 99543074 missense possibly damaging 0.53
R4716:Krt40 UTSW 11 99540219 missense probably damaging 1.00
R5886:Krt40 UTSW 11 99540081 missense probably benign 0.34
R6232:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6233:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6235:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6248:Krt40 UTSW 11 99541740 missense possibly damaging 0.95
R7064:Krt40 UTSW 11 99540128 missense probably benign 0.32
R7400:Krt40 UTSW 11 99543143 missense probably benign 0.00
R7589:Krt40 UTSW 11 99540157 missense probably damaging 1.00
R7831:Krt40 UTSW 11 99541261 missense probably benign 0.06
R7838:Krt40 UTSW 11 99540135 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATTGGATACCCAGACCTGC -3'
(R):5'- CTCAACAAGGTCCTGGATGAG -3'

Sequencing Primer
(F):5'- CCTGGACTTCTGTCAAAGAGCATAG -3'
(R):5'- TCCTGGATGAGATGCGATGTCAATAC -3'
Posted On2014-08-25