Incidental Mutation 'R1994:Rictor'
ID224207
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1994 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6776156 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 608 (F608L)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: F608L

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: F608L

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,282,670 probably null Het
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Cidec T A 6: 113,428,232 Y159F probably damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fbln2 A G 6: 91,234,301 E409G probably damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Klk1b9 C T 7: 43,979,555 T161I probably benign Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc35a2 T A X: 7,892,825 L110Q probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAATCCGTGAACTGTGCCAAAG -3'
(R):5'- GGCTAAGCTTGTATTTCAAACAGC -3'

Sequencing Primer
(F):5'- CGTGAACTGTGCCAAAGTGTTTAATG -3'
(R):5'- GTTCAAGGTAAGCATGGCCTACATC -3'
Posted On2014-08-25