Incidental Mutation 'R2022:Dym'
ID224241
Institutional Source Beutler Lab
Gene Symbol Dym
Ensembl Gene ENSMUSG00000035765
Gene Namedymeclin
SynonymsC030019K18Rik, 4933427L07Rik, 1810041M12Rik
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2022 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location75018772-75286966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75080250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 181 (V181A)
Ref Sequence ENSEMBL: ENSMUSP00000047054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039608]
Predicted Effect probably benign
Transcript: ENSMUST00000039608
AA Change: V181A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: V181A

DomainStartEndE-ValueType
Pfam:Dymeclin 1 646 3.3e-174 PFAM
Pfam:Hid1 309 584 3e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Krt40 T A 11: 99,539,992 E285D probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Prom1 G T 5: 44,029,726 D396E probably benign Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tm9sf3 A G 19: 41,238,792 F280S probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Wdr66 G A 5: 123,273,790 G495D probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Dym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Dym APN 18 75119249 missense probably benign 0.43
IGL01593:Dym APN 18 75114781 splice site probably benign
IGL02657:Dym APN 18 75082456 nonsense probably null
IGL02716:Dym APN 18 75286683 missense probably damaging 1.00
IGL02977:Dym APN 18 75063175 critical splice donor site probably null
asesino UTSW 18 75056641 missense probably damaging 1.00
flavor UTSW 18 75056738 nonsense probably null
geschmack UTSW 18 75063174 critical splice donor site probably null
sabor UTSW 18 75125539 critical splice donor site probably null
R0042:Dym UTSW 18 75125539 critical splice donor site probably null
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0320:Dym UTSW 18 75199262 missense probably damaging 0.99
R0943:Dym UTSW 18 75286769 makesense probably null
R1677:Dym UTSW 18 75125512 missense probably damaging 1.00
R2221:Dym UTSW 18 75230165 missense probably damaging 1.00
R2292:Dym UTSW 18 75199212 missense possibly damaging 0.95
R4087:Dym UTSW 18 75230101 missense probably damaging 1.00
R4929:Dym UTSW 18 75243286 missense probably damaging 1.00
R5033:Dym UTSW 18 75119161 missense possibly damaging 0.78
R6489:Dym UTSW 18 75080226 missense probably benign 0.27
R6641:Dym UTSW 18 75056641 missense probably damaging 1.00
R6751:Dym UTSW 18 75286647 missense probably damaging 0.98
R6864:Dym UTSW 18 75056738 nonsense probably null
R7284:Dym UTSW 18 75119171 missense possibly damaging 0.60
R7319:Dym UTSW 18 75063174 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGATGCCAAGTCCAAACAG -3'
(R):5'- GGTTGGTAAAATGACAACACCC -3'

Sequencing Primer
(F):5'- CCAGAAAGGGGGTTAATATTTTGGC -3'
(R):5'- GGTAAAATGACAACACCCATGAAAAG -3'
Posted On2014-08-25