Incidental Mutation 'R1994:Slc35a2'
ID224246
Institutional Source Beutler Lab
Gene Symbol Slc35a2
Ensembl Gene ENSMUSG00000031156
Gene Namesolute carrier family 35 (UDP-galactose transporter), member A2
SynonymsUGT, Sfc8, Had-1, Had1, Ugalt
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1994 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location7884028-7894492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7892825 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 110 (L110Q)
Ref Sequence ENSEMBL: ENSMUSP00000146481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033497] [ENSMUST00000096514] [ENSMUST00000115654] [ENSMUST00000115655] [ENSMUST00000115660] [ENSMUST00000115663] [ENSMUST00000154552] [ENSMUST00000155967] [ENSMUST00000156741] [ENSMUST00000207114] [ENSMUST00000208397] [ENSMUST00000208633] [ENSMUST00000208640] [ENSMUST00000208718]
Predicted Effect probably benign
Transcript: ENSMUST00000033497
SMART Domains Protein: ENSMUSP00000033497
Gene: ENSMUSG00000031157

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
WW 47 80 6.08e-8 SMART
low complexity region 150 170 N/A INTRINSIC
PDB:4BWQ|H 221 263 2e-22 PDB
Predicted Effect silent
Transcript: ENSMUST00000096514
SMART Domains Protein: ENSMUSP00000094259
Gene: ENSMUSG00000031156

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 37 56 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Pfam:Nuc_sug_transp 96 146 8.6e-17 PFAM
low complexity region 164 174 N/A INTRINSIC
low complexity region 196 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115654
SMART Domains Protein: ENSMUSP00000111318
Gene: ENSMUSG00000031157

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
WW 47 80 6.08e-8 SMART
low complexity region 150 170 N/A INTRINSIC
PDB:4BWQ|H 221 263 2e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000115655
SMART Domains Protein: ENSMUSP00000111319
Gene: ENSMUSG00000031157

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
WW 47 80 6.08e-8 SMART
low complexity region 150 170 N/A INTRINSIC
PDB:4BWQ|H 221 263 2e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000115660
AA Change: L371Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111324
Gene: ENSMUSG00000031156
AA Change: L371Q

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 37 56 N/A INTRINSIC
Pfam:EamA 65 183 4.4e-7 PFAM
Pfam:EmrE 80 191 4.6e-10 PFAM
Pfam:UAA 80 346 5.2e-11 PFAM
Pfam:Nuc_sug_transp 96 331 5.3e-101 PFAM
low complexity region 360 370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115663
AA Change: L371Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111327
Gene: ENSMUSG00000031156
AA Change: L371Q

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Nuc_sug_transp 31 339 2.9e-137 PFAM
low complexity region 360 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123277
SMART Domains Protein: ENSMUSP00000116270
Gene: ENSMUSG00000031156

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:Nuc_sug_transp 20 144 2.5e-46 PFAM
low complexity region 147 162 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000153620
SMART Domains Protein: ENSMUSP00000120681
Gene: ENSMUSG00000031156

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Nuc_sug_transp 30 145 4.3e-41 PFAM
low complexity region 163 173 N/A INTRINSIC
low complexity region 203 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154552
SMART Domains Protein: ENSMUSP00000114924
Gene: ENSMUSG00000031157

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
WW 47 80 6.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155967
AA Change: L371Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000156741
SMART Domains Protein: ENSMUSP00000123657
Gene: ENSMUSG00000031157

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
WW 47 80 6.08e-8 SMART
low complexity region 150 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207114
Predicted Effect probably benign
Transcript: ENSMUST00000208397
AA Change: L310Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000208633
Predicted Effect probably benign
Transcript: ENSMUST00000208640
Predicted Effect probably damaging
Transcript: ENSMUST00000208718
AA Change: L110Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,282,670 probably null Het
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Cidec T A 6: 113,428,232 Y159F probably damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fbln2 A G 6: 91,234,301 E409G probably damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Klk1b9 C T 7: 43,979,555 T161I probably benign Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Rictor T C 15: 6,776,156 F608L probably benign Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Slc35a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Slc35a2 UTSW X 7889662 missense probably damaging 1.00
Z1177:Slc35a2 UTSW X 7892878 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTGTGCTGTCCACTGTTGC -3'
(R):5'- ATGTGACATTCAGCCCTAGTTCC -3'

Sequencing Primer
(F):5'- GTCCACTGTTGCCTCCATTCG -3'
(R):5'- CCATATCCCTCTAGAATTATGGGAG -3'
Posted On2014-08-25