Incidental Mutation 'R2034:Ncoa2'
ID 224255
Institutional Source Beutler Lab
Gene Symbol Ncoa2
Ensembl Gene ENSMUSG00000005886
Gene Name nuclear receptor coactivator 2
Synonyms SRC-2, TIF2, glucocorticoid receptor-interacting protein 1, D1Ertd433e, KAT13C, bHLHe75, TIF2/GRIP-1, TIF-2, Grip1
MMRRC Submission 040041-MU
Accession Numbers

Ncbi RefSeq: NM_008678.2, NM_001077695.1; MGI: 1276533
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R2034 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 13139105-13374083 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13164983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 909 (S909G)
Ref Sequence ENSEMBL: ENSMUSP00000006037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006037] [ENSMUST00000068304] [ENSMUST00000081713]
AlphaFold Q61026
PDB Structure Human Estrogen Receptor alpha Ligand-binding Domain in Complex with (R,R)-5,11-cis-diethyl-5,6,11,12-tetrahydrochrysene-2,8-diol and a Glucocorticoid Receptor Interacting Protein 1 NR box II Peptide [X-RAY DIFFRACTION]
STRUCTURAL BASIS FOR BILE ACID BINDING AND ACTIVATION OF THE NUCLEAR RECEPTOR FXR [X-RAY DIFFRACTION]
PPARgamma in complex with a 2-BABA compound [X-RAY DIFFRACTION]
Crystal Structure of Estrogen Receptor alpha Complexed to a B-N Substituted Ligand [X-RAY DIFFRACTION]
Crystal Structure of Estrogen Receptor Alpha mutant 537S Complexed with 4-(6-hydroxy-1H-indazol-3-yl)benzene-1,3-diol [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Mutant 537S Complexed with Genistein [X-RAY DIFFRACTION]
Crystal Structure of Estrogen Receptor Alpha Ligand Binding Domain Mutant 537S Complexed with an Ethyl Indazole Compound [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed to an Ether Estradiol Compound [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed with a Chloro-Indazole Compound [X-RAY DIFFRACTION]
Crystal Structure of the Estrogen Receptor Alpha Ligand Binding Domain Complexed with an Oxabicyclic diarylethylene Compound [X-RAY DIFFRACTION]
>> 8 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000006037
AA Change: S909G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000006037
Gene: ENSMUSG00000005886
AA Change: S909G

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:NCOA_u2 463 587 6.7e-39 PFAM
Pfam:SRC-1 636 709 5.8e-23 PFAM
Pfam:DUF4927 731 816 2.7e-33 PFAM
low complexity region 1021 1037 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1071 1117 6.5e-27 PFAM
low complexity region 1183 1204 N/A INTRINSIC
low complexity region 1243 1264 N/A INTRINSIC
DUF1518 1279 1336 5.92e-28 SMART
low complexity region 1409 1420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068304
SMART Domains Protein: ENSMUSP00000069509
Gene: ENSMUSG00000005886

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081713
SMART Domains Protein: ENSMUSP00000080413
Gene: ENSMUSG00000005886

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147927
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 2183803
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a transcriptional coactivator for nuclear hormone receptors, including steroid, thyroid, retinoid, and vitamin D receptors. The encoded protein acts as an intermediary factor for the ligand-dependent activity of these nuclear receptors, which regulate their target genes upon binding of cognate response elements. This gene has been found to be involved in translocations that result in fusions with other genes in various cancers, including the lysine acetyltransferase 6A (KAT6A) gene in acute myeloid leukemia, the ETS variant 6 (ETV6) gene in acute lymphoblastic leukemia, and the hes related family bHLH transcription factor with YRPW motif 1 (HEY1) gene in mesenchymal chondrosarcoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice exhibit a transient postnatal growth deficiency and hypofertility. Male hypofertility is due to defects in spermiogenesis and an age-dependent testicular degeneration preceded by defective lipid metabolism in Sertoli cells. Female hypofertility is due to a placental hypoplasia. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted(4) Gene trapped(39)
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Ncoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Ncoa2 APN 1 13149079 missense possibly damaging 0.91
IGL01469:Ncoa2 APN 1 13186869 missense probably benign 0.02
IGL01735:Ncoa2 APN 1 13164903 missense probably benign 0.01
IGL01799:Ncoa2 APN 1 13152375 splice site probably benign
IGL02023:Ncoa2 APN 1 13174854 missense probably damaging 1.00
IGL02115:Ncoa2 APN 1 13152817 missense probably damaging 1.00
IGL02263:Ncoa2 APN 1 13174763 missense probably damaging 1.00
IGL03131:Ncoa2 APN 1 13177174 missense probably damaging 0.98
IGL03189:Ncoa2 APN 1 13190136 missense probably damaging 1.00
IGL03240:Ncoa2 APN 1 13177092 missense probably damaging 1.00
Swatch UTSW 1 13181297 missense probably damaging 0.99
R0017:Ncoa2 UTSW 1 13174752 missense probably damaging 1.00
R0056:Ncoa2 UTSW 1 117516497 critical splice donor site probably null
R0158:Ncoa2 UTSW 1 13152384 missense probably benign 0.05
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0684:Ncoa2 UTSW 1 13224651 missense probably damaging 0.99
R0788:Ncoa2 UTSW 1 13166889 splice site probably benign
R1433:Ncoa2 UTSW 1 13148378 missense probably benign 0.01
R1517:Ncoa2 UTSW 1 13165057 missense probably benign 0.33
R1799:Ncoa2 UTSW 1 13162293 splice site probably null
R1959:Ncoa2 UTSW 1 13160252 missense probably damaging 1.00
R2175:Ncoa2 UTSW 1 13224613 missense probably damaging 0.96
R2437:Ncoa2 UTSW 1 13148360 missense probably damaging 0.98
R2851:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R2853:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R4334:Ncoa2 UTSW 1 13174963 missense possibly damaging 0.77
R4365:Ncoa2 UTSW 1 13180547 missense probably damaging 0.96
R4386:Ncoa2 UTSW 1 13177165 missense probably damaging 0.99
R4516:Ncoa2 UTSW 1 13146906 missense probably damaging 0.99
R5109:Ncoa2 UTSW 1 13186846 missense probably damaging 1.00
R5162:Ncoa2 UTSW 1 13175172 missense possibly damaging 0.79
R5183:Ncoa2 UTSW 1 13174366 missense probably damaging 1.00
R5250:Ncoa2 UTSW 1 13224689 missense probably damaging 1.00
R5514:Ncoa2 UTSW 1 13181221 missense probably damaging 1.00
R5691:Ncoa2 UTSW 1 13180550 missense probably damaging 0.99
R5837:Ncoa2 UTSW 1 13224706 utr 5 prime probably benign
R6003:Ncoa2 UTSW 1 13167030 missense possibly damaging 0.81
R6134:Ncoa2 UTSW 1 13174371 missense probably damaging 1.00
R6559:Ncoa2 UTSW 1 13150617 splice site probably null
R6623:Ncoa2 UTSW 1 13181297 missense probably damaging 0.99
R6949:Ncoa2 UTSW 1 13156501 missense possibly damaging 0.92
R7090:Ncoa2 UTSW 1 13186838 missense probably damaging 1.00
R7251:Ncoa2 UTSW 1 13148375 missense probably benign 0.01
R7389:Ncoa2 UTSW 1 13186825 missense possibly damaging 0.62
R7565:Ncoa2 UTSW 1 13148376 missense probably benign 0.03
R7602:Ncoa2 UTSW 1 13177126 missense possibly damaging 0.95
R7661:Ncoa2 UTSW 1 13174537 missense probably damaging 1.00
R7735:Ncoa2 UTSW 1 13148437 missense probably benign 0.31
R8366:Ncoa2 UTSW 1 13180606 missense probably damaging 1.00
R8824:Ncoa2 UTSW 1 13177185 missense probably benign 0.34
R9028:Ncoa2 UTSW 1 13152855 missense probably benign 0.00
R9084:Ncoa2 UTSW 1 13174429 missense probably damaging 1.00
R9745:Ncoa2 UTSW 1 13174968 missense probably benign 0.00
R9792:Ncoa2 UTSW 1 13190131 missense possibly damaging 0.95
R9793:Ncoa2 UTSW 1 13190131 missense possibly damaging 0.95
RF021:Ncoa2 UTSW 1 13149109 critical splice acceptor site probably benign
X0063:Ncoa2 UTSW 1 13175238 missense possibly damaging 0.82
X0066:Ncoa2 UTSW 1 13148449 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AACAAGCCCATGGTCAAGTTC -3'
(R):5'- GCTACAGGAGACATTTTCCCTAAAC -3'

Sequencing Primer
(F):5'- CTACCATTTTGATGTGGACGAACAC -3'
(R):5'- GGAGACATTTTCCCTAAACACTAC -3'
Posted On 2014-08-25