Incidental Mutation 'R1997:Per2'
ID 224256
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Name period circadian clock 2
Synonyms mPer2
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R1997 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 91343704-91387046 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91368581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 264 (E264G)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069620
AA Change: E264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: E264G

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91,376,555 (GRCm39) missense probably damaging 0.98
IGL01350:Per2 APN 1 91,358,583 (GRCm39) missense probably damaging 1.00
IGL01865:Per2 APN 1 91,349,239 (GRCm39) missense probably benign 0.10
IGL01974:Per2 APN 1 91,351,440 (GRCm39) missense probably benign 0.02
IGL02118:Per2 APN 1 91,352,031 (GRCm39) missense probably damaging 0.99
IGL02271:Per2 APN 1 91,373,332 (GRCm39) missense probably damaging 1.00
IGL02533:Per2 APN 1 91,358,724 (GRCm39) missense possibly damaging 0.92
IGL02707:Per2 APN 1 91,378,450 (GRCm39) missense possibly damaging 0.94
IGL02972:Per2 APN 1 91,351,703 (GRCm39) missense possibly damaging 0.50
IGL03118:Per2 APN 1 91,372,341 (GRCm39) nonsense probably null
IGL03125:Per2 APN 1 91,378,333 (GRCm39) missense probably benign 0.00
IGL03375:Per2 APN 1 91,351,950 (GRCm39) missense possibly damaging 0.76
IGL03388:Per2 APN 1 91,372,511 (GRCm39) splice site probably benign
Kortiku UTSW 1 91,351,551 (GRCm39) missense probably damaging 1.00
obst UTSW 1 91,373,261 (GRCm39) missense probably benign 0.00
R7092_Per2_246 UTSW 1 91,349,153 (GRCm39) missense probably damaging 1.00
rhythm UTSW 1 91,357,104 (GRCm39) critical splice donor site probably null
ANU23:Per2 UTSW 1 91,376,555 (GRCm39) missense probably damaging 0.98
R0029:Per2 UTSW 1 91,351,434 (GRCm39) missense possibly damaging 0.58
R0029:Per2 UTSW 1 91,351,434 (GRCm39) missense possibly damaging 0.58
R0542:Per2 UTSW 1 91,366,054 (GRCm39) critical splice donor site probably null
R0764:Per2 UTSW 1 91,357,142 (GRCm39) missense probably damaging 1.00
R1370:Per2 UTSW 1 91,373,279 (GRCm39) missense possibly damaging 0.94
R1655:Per2 UTSW 1 91,376,490 (GRCm39) missense probably damaging 1.00
R1688:Per2 UTSW 1 91,351,551 (GRCm39) missense probably damaging 1.00
R2891:Per2 UTSW 1 91,373,325 (GRCm39) missense probably damaging 1.00
R2893:Per2 UTSW 1 91,373,325 (GRCm39) missense probably damaging 1.00
R2894:Per2 UTSW 1 91,373,325 (GRCm39) missense probably damaging 1.00
R3109:Per2 UTSW 1 91,373,297 (GRCm39) missense probably benign 0.02
R4125:Per2 UTSW 1 91,357,172 (GRCm39) missense possibly damaging 0.71
R4997:Per2 UTSW 1 91,378,505 (GRCm39) missense probably benign 0.02
R5110:Per2 UTSW 1 91,357,237 (GRCm39) missense possibly damaging 0.57
R5478:Per2 UTSW 1 91,360,590 (GRCm39) missense probably benign 0.09
R5590:Per2 UTSW 1 91,355,578 (GRCm39) nonsense probably null
R5634:Per2 UTSW 1 91,372,429 (GRCm39) missense probably benign 0.02
R5654:Per2 UTSW 1 91,373,223 (GRCm39) splice site probably null
R5928:Per2 UTSW 1 91,372,373 (GRCm39) missense probably damaging 1.00
R6241:Per2 UTSW 1 91,349,251 (GRCm39) missense probably damaging 0.97
R6295:Per2 UTSW 1 91,377,594 (GRCm39) missense unknown
R6345:Per2 UTSW 1 91,376,444 (GRCm39) missense probably damaging 1.00
R6480:Per2 UTSW 1 91,357,104 (GRCm39) critical splice donor site probably null
R6502:Per2 UTSW 1 91,355,485 (GRCm39) missense probably benign 0.01
R6702:Per2 UTSW 1 91,355,671 (GRCm39) missense probably damaging 1.00
R6703:Per2 UTSW 1 91,355,671 (GRCm39) missense probably damaging 1.00
R6790:Per2 UTSW 1 91,373,261 (GRCm39) missense probably benign 0.00
R7043:Per2 UTSW 1 91,347,130 (GRCm39) missense probably benign
R7092:Per2 UTSW 1 91,349,153 (GRCm39) missense probably damaging 1.00
R7430:Per2 UTSW 1 91,351,705 (GRCm39) nonsense probably null
R7555:Per2 UTSW 1 91,362,857 (GRCm39) missense probably damaging 1.00
R7860:Per2 UTSW 1 91,372,481 (GRCm39) missense probably damaging 0.99
R8046:Per2 UTSW 1 91,363,425 (GRCm39) missense possibly damaging 0.56
R8142:Per2 UTSW 1 91,349,269 (GRCm39) missense possibly damaging 0.90
R8261:Per2 UTSW 1 91,361,170 (GRCm39) missense possibly damaging 0.87
R8277:Per2 UTSW 1 91,348,274 (GRCm39) missense probably benign 0.15
R8534:Per2 UTSW 1 91,351,659 (GRCm39) missense probably benign 0.09
R8685:Per2 UTSW 1 91,378,402 (GRCm39) missense possibly damaging 0.88
R8703:Per2 UTSW 1 91,351,767 (GRCm39) missense possibly damaging 0.92
R9100:Per2 UTSW 1 91,351,464 (GRCm39) missense possibly damaging 0.91
R9228:Per2 UTSW 1 91,366,081 (GRCm39) missense probably damaging 1.00
R9257:Per2 UTSW 1 91,376,445 (GRCm39) missense probably damaging 1.00
R9429:Per2 UTSW 1 91,351,489 (GRCm39) missense probably benign
X0011:Per2 UTSW 1 91,348,311 (GRCm39) missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91,349,215 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCTTCATACAGTAGCATGTAGC -3'
(R):5'- GCAAGGCTGTAAACTTGTAGGG -3'

Sequencing Primer
(F):5'- ACTCCAGGGGGTTTTCACACAG -3'
(R):5'- GCAGTGAAATCTGGTCTACGGC -3'
Posted On 2014-08-25