Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Per2'

224256

Institutional Source

Beutler Lab

Gene Symbol

Per2

Ensembl Gene

ENSMUSG00000055866

Gene Name

period circadian clock 2

Synonyms

mPer2

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91415982-91459324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91440859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 264 (E264G)

Ref Sequence

ENSEMBL: ENSMUSP00000066620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069620]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069620
AA Change: E264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: E264G

Domain	Start	End	E-Value	Type
PAS	179	246	3.23e1	SMART
PAS	319	385	5.75e-2	SMART
PAC	393	436	1.6e0	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	821	834	N/A	INTRINSIC
low complexity region	996	1014	N/A	INTRINSIC
Pfam:Period_C	1040	1234	2.7e-93	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Per2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Per2	APN	1	91448833	missense	probably damaging	0.98
IGL01350:Per2	APN	1	91430861	missense	probably damaging	1.00
IGL01865:Per2	APN	1	91421517	missense	probably benign	0.10
IGL01974:Per2	APN	1	91423718	missense	probably benign	0.02
IGL02118:Per2	APN	1	91424309	missense	probably damaging	0.99
IGL02271:Per2	APN	1	91445610	missense	probably damaging	1.00
IGL02533:Per2	APN	1	91431002	missense	possibly damaging	0.92
IGL02707:Per2	APN	1	91450728	missense	possibly damaging	0.94
IGL02972:Per2	APN	1	91423981	missense	possibly damaging	0.50
IGL03118:Per2	APN	1	91444619	nonsense	probably null
IGL03125:Per2	APN	1	91450611	missense	probably benign	0.00
IGL03375:Per2	APN	1	91424228	missense	possibly damaging	0.76
IGL03388:Per2	APN	1	91444789	splice site	probably benign
Kortiku	UTSW	1	91423829	missense	probably damaging	1.00
obst	UTSW	1	91445539	missense	probably benign	0.00
R7092_Per2_246	UTSW	1	91421431	missense	probably damaging	1.00
rhythm	UTSW	1	91429382	critical splice donor site	probably null
ANU23:Per2	UTSW	1	91448833	missense	probably damaging	0.98
R0029:Per2	UTSW	1	91423712	missense	possibly damaging	0.58
R0029:Per2	UTSW	1	91423712	missense	possibly damaging	0.58
R0542:Per2	UTSW	1	91438332	critical splice donor site	probably null
R0764:Per2	UTSW	1	91429420	missense	probably damaging	1.00
R1370:Per2	UTSW	1	91445557	missense	possibly damaging	0.94
R1655:Per2	UTSW	1	91448768	missense	probably damaging	1.00
R1688:Per2	UTSW	1	91423829	missense	probably damaging	1.00
R2891:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R2893:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R2894:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R3109:Per2	UTSW	1	91445575	missense	probably benign	0.02
R4125:Per2	UTSW	1	91429450	missense	possibly damaging	0.71
R4997:Per2	UTSW	1	91450783	missense	probably benign	0.02
R5110:Per2	UTSW	1	91429515	missense	possibly damaging	0.57
R5478:Per2	UTSW	1	91432868	missense	probably benign	0.09
R5590:Per2	UTSW	1	91427856	nonsense	probably null
R5634:Per2	UTSW	1	91444707	missense	probably benign	0.02
R5654:Per2	UTSW	1	91445501	splice site	probably null
R5928:Per2	UTSW	1	91444651	missense	probably damaging	1.00
R6241:Per2	UTSW	1	91421529	missense	probably damaging	0.97
R6295:Per2	UTSW	1	91449872	missense	unknown
R6345:Per2	UTSW	1	91448722	missense	probably damaging	1.00
R6480:Per2	UTSW	1	91429382	critical splice donor site	probably null
R6502:Per2	UTSW	1	91427763	missense	probably benign	0.01
R6702:Per2	UTSW	1	91427949	missense	probably damaging	1.00
R6703:Per2	UTSW	1	91427949	missense	probably damaging	1.00
R6790:Per2	UTSW	1	91445539	missense	probably benign	0.00
R7043:Per2	UTSW	1	91419408	missense	probably benign
R7092:Per2	UTSW	1	91421431	missense	probably damaging	1.00
R7430:Per2	UTSW	1	91423983	nonsense	probably null
R7555:Per2	UTSW	1	91435135	missense	probably damaging	1.00
R7860:Per2	UTSW	1	91444759	missense	probably damaging	0.99
R8046:Per2	UTSW	1	91435703	missense	possibly damaging	0.56
R8142:Per2	UTSW	1	91421547	missense	possibly damaging	0.90
R8261:Per2	UTSW	1	91433448	missense	possibly damaging	0.87
R8277:Per2	UTSW	1	91420552	missense	probably benign	0.15
R8534:Per2	UTSW	1	91423937	missense	probably benign	0.09
R8685:Per2	UTSW	1	91450680	missense	possibly damaging	0.88
R8703:Per2	UTSW	1	91424045	missense	possibly damaging	0.92
R9100:Per2	UTSW	1	91423742	missense	possibly damaging	0.91
R9228:Per2	UTSW	1	91438359	missense	probably damaging	1.00
R9257:Per2	UTSW	1	91448723	missense	probably damaging	1.00
R9429:Per2	UTSW	1	91423767	missense	probably benign
X0011:Per2	UTSW	1	91420589	missense	possibly damaging	0.85
Z1176:Per2	UTSW	1	91421493	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCCCTTCATACAGTAGCATGTAGC -3'
(R):5'- GCAAGGCTGTAAACTTGTAGGG -3'

Sequencing Primer
(F):5'- ACTCCAGGGGGTTTTCACACAG -3'
(R):5'- GCAGTGAAATCTGGTCTACGGC -3'

Posted On

2014-08-25