Incidental Mutation 'R0143:Notch2'
ID22426
Institutional Source Beutler Lab
Gene Symbol Notch2
Ensembl Gene ENSMUSG00000027878
Gene Namenotch 2
SynonymsN2, Motch B
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location98013527-98150361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98146117 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2032 (D2032G)
Ref Sequence ENSEMBL: ENSMUSP00000078741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079812]
Predicted Effect probably damaging
Transcript: ENSMUST00000079812
AA Change: D2032G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: D2032G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 27 63 5.79e-2 SMART
EGF 67 102 1.54e-6 SMART
EGF 108 143 6.25e-7 SMART
EGF 147 180 5.28e-5 SMART
EGF_CA 182 219 6.14e-15 SMART
EGF 224 258 5.08e-7 SMART
EGF_CA 260 296 1.95e-8 SMART
EGF_CA 298 336 3.91e-8 SMART
EGF_CA 338 374 7.69e-7 SMART
EGF 378 413 6.86e-4 SMART
EGF_CA 415 454 4.15e-12 SMART
EGF_CA 456 492 3.24e-14 SMART
EGF_CA 494 530 4.77e-12 SMART
EGF_CA 532 568 2.04e-11 SMART
EGF_CA 570 605 1.18e-7 SMART
EGF_CA 607 643 7.12e-11 SMART
EGF_CA 645 680 1.82e-8 SMART
EGF_CA 682 718 1.42e-10 SMART
EGF_CA 720 755 1.25e-6 SMART
EGF_CA 757 793 3.61e-12 SMART
EGF_CA 795 831 1.53e-10 SMART
EGF 836 871 1.34e-6 SMART
EGF_CA 873 909 6.05e-14 SMART
EGF_CA 911 947 9.54e-12 SMART
EGF_CA 949 985 1.39e-13 SMART
EGF_CA 987 1023 1.26e-11 SMART
EGF_CA 1025 1061 9.31e-15 SMART
EGF 1066 1099 1.39e-4 SMART
EGF 1104 1147 2.6e-4 SMART
EGF_CA 1149 1185 1.55e-11 SMART
EGF_CA 1187 1223 2.74e-12 SMART
EGF_CA 1225 1262 4.15e-12 SMART
EGF 1267 1302 1.43e-1 SMART
EGF 1307 1343 2.33e-6 SMART
EGF 1377 1412 9.85e-5 SMART
NL 1418 1456 8.55e-19 SMART
NL 1459 1497 2.27e-14 SMART
NL 1498 1535 1.16e-11 SMART
NOD 1539 1595 3.4e-28 SMART
NODP 1619 1679 1.66e-22 SMART
transmembrane domain 1680 1702 N/A INTRINSIC
ANK 1828 1872 2.18e2 SMART
ANK 1877 1906 3.36e-2 SMART
ANK 1910 1940 1.81e2 SMART
ANK 1944 1973 6.61e-1 SMART
ANK 1977 2006 5.24e-4 SMART
ANK 2010 2039 3.41e-3 SMART
low complexity region 2179 2193 N/A INTRINSIC
low complexity region 2232 2241 N/A INTRINSIC
DUF3454 2382 2447 4.62e-30 SMART
Meta Mutation Damage Score 0.2904 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Notch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Notch2 APN 3 98111675 missense possibly damaging 0.77
IGL01517:Notch2 APN 3 98138655 missense probably benign 0.16
IGL01630:Notch2 APN 3 98146618 missense possibly damaging 0.77
IGL01637:Notch2 APN 3 98146060 missense probably damaging 1.00
IGL01828:Notch2 APN 3 98072613 missense probably damaging 1.00
IGL01998:Notch2 APN 3 98143106 missense probably damaging 1.00
IGL02008:Notch2 APN 3 98147296 missense probably damaging 1.00
IGL02030:Notch2 APN 3 98099421 splice site probably null
IGL02155:Notch2 APN 3 98138490 missense probably damaging 0.98
IGL02268:Notch2 APN 3 98137397 missense probably damaging 1.00
IGL02301:Notch2 APN 3 98141554 missense probably benign 0.08
IGL02336:Notch2 APN 3 98138395 missense possibly damaging 0.73
IGL02340:Notch2 APN 3 98147336 nonsense probably null
IGL02536:Notch2 APN 3 98102407 missense probably benign 0.03
IGL02589:Notch2 APN 3 98104347 critical splice acceptor site probably null
IGL02633:Notch2 APN 3 98116697 splice site probably benign
IGL02691:Notch2 APN 3 98135607 nonsense probably null
IGL02832:Notch2 APN 3 98137373 missense probably benign 0.12
IGL02894:Notch2 APN 3 98102432 nonsense probably null
IGL02902:Notch2 APN 3 98111574 missense probably damaging 1.00
IGL02967:Notch2 APN 3 98146144 missense probably damaging 0.99
IGL03015:Notch2 APN 3 98072649 missense possibly damaging 0.83
PIT4378001:Notch2 UTSW 3 98142956 missense probably damaging 1.00
PIT4519001:Notch2 UTSW 3 98098108 missense probably damaging 1.00
PIT4581001:Notch2 UTSW 3 98104462 missense probably damaging 1.00
R0111:Notch2 UTSW 3 98138761 missense probably benign 0.00
R0129:Notch2 UTSW 3 98146620 missense probably benign 0.08
R0480:Notch2 UTSW 3 98146537 missense possibly damaging 0.88
R0523:Notch2 UTSW 3 98070970 missense probably benign 0.34
R0523:Notch2 UTSW 3 98111598 missense probably benign 0.00
R0531:Notch2 UTSW 3 98102451 splice site probably benign
R0537:Notch2 UTSW 3 98116741 missense possibly damaging 0.70
R0987:Notch2 UTSW 3 98134677 splice site probably null
R1485:Notch2 UTSW 3 98100257 missense probably benign 0.00
R1555:Notch2 UTSW 3 98131340 missense possibly damaging 0.93
R1625:Notch2 UTSW 3 98111575 missense probably damaging 1.00
R1699:Notch2 UTSW 3 98145127 missense probably damaging 1.00
R1765:Notch2 UTSW 3 98121926 missense probably damaging 1.00
R1794:Notch2 UTSW 3 98099547 missense possibly damaging 0.53
R1974:Notch2 UTSW 3 98072755 missense probably damaging 1.00
R2086:Notch2 UTSW 3 98102367 missense probably damaging 1.00
R2099:Notch2 UTSW 3 98115321 missense possibly damaging 0.79
R3778:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R3924:Notch2 UTSW 3 98122034 nonsense probably null
R4018:Notch2 UTSW 3 98104565 missense probably damaging 1.00
R4151:Notch2 UTSW 3 98147071 missense possibly damaging 0.95
R4417:Notch2 UTSW 3 98131270 missense possibly damaging 0.95
R4510:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4511:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4636:Notch2 UTSW 3 98146104 missense probably benign 0.02
R4661:Notch2 UTSW 3 98135513 missense probably damaging 1.00
R4856:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4886:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4945:Notch2 UTSW 3 98111721 missense probably benign 0.01
R4970:Notch2 UTSW 3 98101636 critical splice donor site probably null
R4974:Notch2 UTSW 3 98139633 missense probably benign 0.39
R5082:Notch2 UTSW 3 98100374 missense probably damaging 1.00
R5112:Notch2 UTSW 3 98101636 critical splice donor site probably null
R5156:Notch2 UTSW 3 98124310 missense possibly damaging 0.53
R5433:Notch2 UTSW 3 98126134 missense probably damaging 1.00
R5539:Notch2 UTSW 3 98137582 missense probably damaging 0.99
R5813:Notch2 UTSW 3 98135428 missense probably benign
R5827:Notch2 UTSW 3 98072862 missense possibly damaging 0.64
R5908:Notch2 UTSW 3 98123923 intron probably benign
R6021:Notch2 UTSW 3 98121972 missense probably damaging 1.00
R6090:Notch2 UTSW 3 98135377 nonsense probably null
R6103:Notch2 UTSW 3 98135743 missense possibly damaging 0.94
R6111:Notch2 UTSW 3 98146293 missense probably benign 0.00
R6168:Notch2 UTSW 3 98145217 missense probably damaging 1.00
R6382:Notch2 UTSW 3 98141543 missense probably damaging 1.00
R6404:Notch2 UTSW 3 98081998 missense probably damaging 1.00
R6419:Notch2 UTSW 3 98100389 critical splice donor site probably null
R6454:Notch2 UTSW 3 98137406 missense possibly damaging 0.47
R6626:Notch2 UTSW 3 98101605 missense probably damaging 1.00
R6629:Notch2 UTSW 3 98120881 missense possibly damaging 0.65
R6706:Notch2 UTSW 3 98138430 missense possibly damaging 0.94
R6735:Notch2 UTSW 3 98134586 missense probably damaging 1.00
R6837:Notch2 UTSW 3 98070854 splice site probably null
R7021:Notch2 UTSW 3 98135446 missense probably benign
R7028:Notch2 UTSW 3 98102387 missense probably damaging 1.00
R7228:Notch2 UTSW 3 98137317 nonsense probably null
R7320:Notch2 UTSW 3 98131327 missense possibly damaging 0.94
R7361:Notch2 UTSW 3 98131402 missense probably benign 0.04
R7562:Notch2 UTSW 3 98113114 missense probably damaging 1.00
R7630:Notch2 UTSW 3 98137508 missense possibly damaging 0.65
R7637:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R7748:Notch2 UTSW 3 98138484 missense possibly damaging 0.69
R7764:Notch2 UTSW 3 98142988 missense probably damaging 1.00
R7817:Notch2 UTSW 3 98107127 missense probably damaging 1.00
R8136:Notch2 UTSW 3 98124221 missense probably damaging 1.00
R8159:Notch2 UTSW 3 98120922 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGAGGTACACTTGTGTTTGAGCTGC -3'
(R):5'- TCAGACTGAGGAAAGACCTGTTGGG -3'

Sequencing Primer
(F):5'- tttcctcacccctcctttattc -3'
(R):5'- GCCCACAGAGGACAGGTG -3'
Posted On2013-04-16