Incidental Mutation 'R1997:Camsap2'
ID224266
Institutional Source Beutler Lab
Gene Symbol Camsap2
Ensembl Gene ENSMUSG00000041570
Gene Namecalmodulin regulated spectrin-associated protein family, member 2
Synonyms1600013L13Rik, Camsap1l1, 4930541M15Rik
MMRRC Submission 040007-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R1997 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136268123-136346104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136271545 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 708 (K708E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048309] [ENSMUST00000192001] [ENSMUST00000192314]
Predicted Effect probably benign
Transcript: ENSMUST00000048309
AA Change: K1373E

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041920
Gene: ENSMUSG00000041570
AA Change: K1373E

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 239 322 3.6e-37 PFAM
low complexity region 379 388 N/A INTRINSIC
low complexity region 397 410 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
low complexity region 671 690 N/A INTRINSIC
low complexity region 706 711 N/A INTRINSIC
Pfam:CAMSAP_CC1 738 795 7.3e-28 PFAM
coiled coil region 878 916 N/A INTRINSIC
low complexity region 922 929 N/A INTRINSIC
low complexity region 943 956 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
coiled coil region 1155 1227 N/A INTRINSIC
low complexity region 1242 1256 N/A INTRINSIC
CAMSAP_CKK 1337 1466 1.59e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181385
Predicted Effect probably benign
Transcript: ENSMUST00000192001
AA Change: K1356E

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142166
Gene: ENSMUSG00000041570
AA Change: K1356E

DomainStartEndE-ValueType
Pfam:CH 178 324 1.1e-37 PFAM
Pfam:CAMSAP_CH 222 305 2.7e-36 PFAM
low complexity region 362 371 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
low complexity region 654 673 N/A INTRINSIC
low complexity region 689 694 N/A INTRINSIC
coiled coil region 729 767 N/A INTRINSIC
coiled coil region 861 899 N/A INTRINSIC
low complexity region 905 912 N/A INTRINSIC
low complexity region 926 939 N/A INTRINSIC
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
coiled coil region 1138 1210 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
CAMSAP_CKK 1320 1449 1.59e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192314
AA Change: K1367E

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142299
Gene: ENSMUSG00000041570
AA Change: K1367E

DomainStartEndE-ValueType
Pfam:CH 178 335 1.2e-35 PFAM
Pfam:CAMSAP_CH 233 316 3.2e-34 PFAM
low complexity region 373 382 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 477 485 N/A INTRINSIC
low complexity region 665 684 N/A INTRINSIC
low complexity region 700 705 N/A INTRINSIC
coiled coil region 740 778 N/A INTRINSIC
coiled coil region 872 910 N/A INTRINSIC
low complexity region 916 923 N/A INTRINSIC
low complexity region 937 950 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1087 1101 N/A INTRINSIC
coiled coil region 1149 1221 N/A INTRINSIC
low complexity region 1236 1250 N/A INTRINSIC
CAMSAP_CKK 1331 1460 1.2e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194808
AA Change: K708E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dhcr7 T G 7: 143,847,430 D446E probably damaging Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Fkbp10 T C 11: 100,416,015 F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kcnh1 G A 1: 192,276,935 V266I probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Sec23a T A 12: 59,002,007 I110L probably benign Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Camsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Camsap2 APN 1 136297790 missense probably benign 0.23
IGL02727:Camsap2 APN 1 136304312 missense probably benign
IGL02803:Camsap2 APN 1 136281123 missense probably damaging 1.00
IGL03037:Camsap2 APN 1 136274857 missense probably damaging 1.00
IGL03124:Camsap2 APN 1 136274799 critical splice donor site probably null
IGL03189:Camsap2 APN 1 136281662 missense probably damaging 1.00
IGL03297:Camsap2 APN 1 136297801 missense probably benign
IGL03347:Camsap2 APN 1 136280986 missense possibly damaging 0.52
ANU23:Camsap2 UTSW 1 136297790 missense probably benign 0.23
PIT4366001:Camsap2 UTSW 1 136280317 missense
R0001:Camsap2 UTSW 1 136282888 unclassified probably benign
R0037:Camsap2 UTSW 1 136281892 missense probably damaging 1.00
R0140:Camsap2 UTSW 1 136280382 missense probably benign
R0194:Camsap2 UTSW 1 136292948 nonsense probably null
R0206:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0208:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0517:Camsap2 UTSW 1 136293388 missense possibly damaging 0.95
R0648:Camsap2 UTSW 1 136304319 missense probably damaging 0.96
R0735:Camsap2 UTSW 1 136292888 missense probably damaging 1.00
R0790:Camsap2 UTSW 1 136273737 splice site probably benign
R0880:Camsap2 UTSW 1 136280970 missense probably benign 0.08
R1559:Camsap2 UTSW 1 136282094 missense probably benign 0.02
R1728:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1729:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1730:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1739:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1762:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1783:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1784:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1785:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1823:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1824:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R2010:Camsap2 UTSW 1 136274868 missense probably damaging 1.00
R2237:Camsap2 UTSW 1 136345331 missense probably damaging 1.00
R2923:Camsap2 UTSW 1 136280809 missense possibly damaging 0.95
R4275:Camsap2 UTSW 1 136270876 missense probably benign 0.01
R4371:Camsap2 UTSW 1 136287963 missense probably damaging 1.00
R4976:Camsap2 UTSW 1 136304386 missense probably damaging 1.00
R5227:Camsap2 UTSW 1 136274891 intron probably benign
R5513:Camsap2 UTSW 1 136280863 missense probably benign 0.23
R5755:Camsap2 UTSW 1 136282327 missense probably damaging 1.00
R5834:Camsap2 UTSW 1 136280388 missense probably benign
R5966:Camsap2 UTSW 1 136276592 missense probably damaging 1.00
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6111:Camsap2 UTSW 1 136281298 missense probably benign
R6147:Camsap2 UTSW 1 136345400 missense probably damaging 1.00
R6284:Camsap2 UTSW 1 136304437 missense possibly damaging 0.63
R6293:Camsap2 UTSW 1 136287920 missense probably damaging 1.00
R6306:Camsap2 UTSW 1 136281199 missense probably benign
R6403:Camsap2 UTSW 1 136280800 nonsense probably null
R6410:Camsap2 UTSW 1 136345444 start gained probably benign
R6943:Camsap2 UTSW 1 136304449 missense probably damaging 1.00
R7268:Camsap2 UTSW 1 136273745 splice site probably null
R7448:Camsap2 UTSW 1 136270906 missense
R7472:Camsap2 UTSW 1 136281393 missense probably damaging 0.96
R7478:Camsap2 UTSW 1 136270940 missense
R7515:Camsap2 UTSW 1 136345370 missense probably damaging 0.99
R7691:Camsap2 UTSW 1 136293004 missense probably damaging 0.99
R7800:Camsap2 UTSW 1 136281901 missense probably damaging 0.99
R8040:Camsap2 UTSW 1 136281247 missense
X0018:Camsap2 UTSW 1 136276575 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACCGTACGCTAATTAAACTG -3'
(R):5'- TCCAGCATGGAAAACTGACAGTG -3'

Sequencing Primer
(F):5'- GTCTTCCAGAACTCTGAGAGTAG -3'
(R):5'- TTTCCTGCAGGACCAAAG -3'
Posted On2014-08-25