Incidental Mutation 'R2034:Rabl6'
ID224271
Institutional Source Beutler Lab
Gene Symbol Rabl6
Ensembl Gene ENSMUSG00000015087
Gene NameRAB, member RAS oncogene family-like 6
SynonymsRbel1, Rbel1a, B230208H17Rik, Rbel1b
MMRRC Submission 040041-MU
Accession Numbers

Genbank: NM_001024616; MGI: 2442633

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25583018-25608521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25585432 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 543 (E543G)
Ref Sequence ENSEMBL: ENSMUSP00000058746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000191602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058137
AA Change: E543G

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087
AA Change: E543G

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114217
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150206
Predicted Effect probably benign
Transcript: ENSMUST00000191602
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small GTPases. The encoded protein binds to both GTP and GDP and may play a role in cell growth and survival. Overexpression of this gene may play a role in breast cancer tumorigenesis, and pseudogenes of this gene are located on the long arm of chromosome 2 and the short arm of chromosome 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Rabl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Rabl6 APN 2 25584120 unclassified probably benign
IGL00742:Rabl6 APN 2 25588687 missense probably damaging 0.96
IGL02231:Rabl6 APN 2 25598184 missense probably benign 0.41
IGL02424:Rabl6 APN 2 25587457 missense probably benign
IGL02514:Rabl6 APN 2 25608176 missense probably damaging 0.96
IGL03036:Rabl6 APN 2 25584856 missense probably benign 0.00
IGL03278:Rabl6 APN 2 25583822 unclassified probably benign
R0017:Rabl6 UTSW 2 25602567 splice site probably benign
R0269:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0442:Rabl6 UTSW 2 25587522 missense probably damaging 0.98
R0617:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0626:Rabl6 UTSW 2 25592766 critical splice donor site probably null
R1109:Rabl6 UTSW 2 25587526 missense probably damaging 1.00
R3914:Rabl6 UTSW 2 25588706 missense possibly damaging 0.91
R4255:Rabl6 UTSW 2 25584779 missense possibly damaging 0.91
R5177:Rabl6 UTSW 2 25585373 missense probably benign 0.18
R5389:Rabl6 UTSW 2 25588654 missense probably damaging 0.96
R6082:Rabl6 UTSW 2 25583825 unclassified probably benign
R6243:Rabl6 UTSW 2 25585403 missense probably damaging 0.98
R6430:Rabl6 UTSW 2 25584837 missense probably damaging 0.96
R6501:Rabl6 UTSW 2 25602447 missense possibly damaging 0.92
R7485:Rabl6 UTSW 2 25584141 missense unknown
R7839:Rabl6 UTSW 2 25592817 missense probably damaging 0.97
R7889:Rabl6 UTSW 2 25584774 critical splice donor site probably null
R7922:Rabl6 UTSW 2 25592817 missense probably damaging 0.97
R7972:Rabl6 UTSW 2 25584774 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGATTGTCCTCTAGCTCTGGAAG -3'
(R):5'- TCAGCAATGCTCAGAGCCTG -3'

Sequencing Primer
(F):5'- CCTCTAGCTCTGGAAGGATGG -3'
(R):5'- GGATTCCCAGAGTATGTCCAG -3'
Posted On2014-08-25