Incidental Mutation 'R1997:Kcnh1'
ID 224272
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms Kv10.1, Eag1, ether a go-go
MMRRC Submission 040007-MU
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R1997 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 192190774-192510159 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 192276935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 266 (V266I)
Ref Sequence ENSEMBL: ENSMUSP00000106468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078470
AA Change: V266I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: V266I

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110844
AA Change: V266I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: V266I

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Camsap2 T C 1: 136,271,545 K708E probably damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dhcr7 T G 7: 143,847,430 D446E probably damaging Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Fkbp10 T C 11: 100,416,015 F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Sec23a T A 12: 59,002,007 I110L probably benign Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R2254:Kcnh1 UTSW 1 192505414 splice site probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
R8375:Kcnh1 UTSW 1 192434816 missense probably damaging 1.00
R8694:Kcnh1 UTSW 1 192238723 critical splice acceptor site probably benign
R8734:Kcnh1 UTSW 1 192506012 missense possibly damaging 0.79
R8809:Kcnh1 UTSW 1 192221414 missense probably damaging 1.00
R9007:Kcnh1 UTSW 1 192505747 missense probably benign 0.01
R9218:Kcnh1 UTSW 1 192453630 missense unknown
R9431:Kcnh1 UTSW 1 192418815 missense probably benign 0.23
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGACATCCTTCCCCAG -3'
(R):5'- CCTGGATCACCCATAAAGGC -3'

Sequencing Primer
(F):5'- TTCCCCAGTACAAGCAAGAGG -3'
(R):5'- GGCACTAACCTCATCCACGTTC -3'
Posted On 2014-08-25