Incidental Mutation 'R1997:Kcnh1'
ID 224272
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms ether a go-go, Eag1, Kv10.1
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R1997 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 191873082-192192467 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 191959243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 266 (V266I)
Ref Sequence ENSEMBL: ENSMUSP00000106468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078470
AA Change: V266I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: V266I

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110844
AA Change: V266I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: V266I

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192,101,190 (GRCm39) missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192,019,901 (GRCm39) missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192,188,164 (GRCm39) missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 191,873,323 (GRCm39) missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192,019,851 (GRCm39) nonsense probably null
IGL02447:Kcnh1 APN 1 191,907,224 (GRCm39) missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192,187,689 (GRCm39) missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 191,903,728 (GRCm39) missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 191,959,223 (GRCm39) missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 191,959,208 (GRCm39) missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192,117,199 (GRCm39) missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192,117,108 (GRCm39) missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 191,959,307 (GRCm39) missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192,019,995 (GRCm39) nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192,100,992 (GRCm39) missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 191,959,113 (GRCm39) missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 191,959,112 (GRCm39) nonsense probably null
R0240:Kcnh1 UTSW 1 192,187,648 (GRCm39) missense probably benign
R0240:Kcnh1 UTSW 1 192,187,648 (GRCm39) missense probably benign
R0422:Kcnh1 UTSW 1 192,019,888 (GRCm39) missense probably benign
R0510:Kcnh1 UTSW 1 192,101,249 (GRCm39) splice site probably benign
R0612:Kcnh1 UTSW 1 191,959,361 (GRCm39) missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192,188,346 (GRCm39) missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192,095,514 (GRCm39) missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 191,959,010 (GRCm39) missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192,188,071 (GRCm39) missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192,095,376 (GRCm39) missense possibly damaging 0.64
R2254:Kcnh1 UTSW 1 192,187,722 (GRCm39) splice site probably null
R2274:Kcnh1 UTSW 1 192,019,829 (GRCm39) missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192,019,829 (GRCm39) missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192,188,368 (GRCm39) missense probably benign 0.00
R3427:Kcnh1 UTSW 1 191,924,238 (GRCm39) missense probably benign 0.06
R3552:Kcnh1 UTSW 1 191,921,074 (GRCm39) missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 191,921,107 (GRCm39) missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192,188,332 (GRCm39) missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 191,959,448 (GRCm39) missense probably benign
R4027:Kcnh1 UTSW 1 191,959,007 (GRCm39) missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192,187,825 (GRCm39) missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 191,959,025 (GRCm39) missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 191,959,388 (GRCm39) missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192,187,783 (GRCm39) missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192,020,055 (GRCm39) missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192,187,836 (GRCm39) missense probably benign 0.00
R5244:Kcnh1 UTSW 1 191,907,184 (GRCm39) missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192,187,999 (GRCm39) missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192,095,385 (GRCm39) missense probably benign 0.01
R6182:Kcnh1 UTSW 1 191,873,361 (GRCm39) missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192,101,089 (GRCm39) missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 191,959,412 (GRCm39) missense probably benign
R6655:Kcnh1 UTSW 1 192,095,391 (GRCm39) missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192,019,949 (GRCm39) missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192,187,597 (GRCm39) makesense probably null
R6972:Kcnh1 UTSW 1 191,959,144 (GRCm39) missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192,019,913 (GRCm39) missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192,187,945 (GRCm39) missense probably benign
R7749:Kcnh1 UTSW 1 191,959,447 (GRCm39) missense probably benign
R7799:Kcnh1 UTSW 1 192,117,183 (GRCm39) missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 191,873,167 (GRCm39) start gained probably benign
R8068:Kcnh1 UTSW 1 191,924,250 (GRCm39) missense probably benign 0.00
R8375:Kcnh1 UTSW 1 192,117,124 (GRCm39) missense probably damaging 1.00
R8694:Kcnh1 UTSW 1 191,921,031 (GRCm39) critical splice acceptor site probably benign
R8734:Kcnh1 UTSW 1 192,188,320 (GRCm39) missense possibly damaging 0.79
R8809:Kcnh1 UTSW 1 191,903,722 (GRCm39) missense probably damaging 1.00
R9007:Kcnh1 UTSW 1 192,188,055 (GRCm39) missense probably benign 0.01
R9218:Kcnh1 UTSW 1 192,135,938 (GRCm39) missense unknown
R9431:Kcnh1 UTSW 1 192,101,123 (GRCm39) missense probably benign 0.23
R9465:Kcnh1 UTSW 1 191,924,233 (GRCm39) missense probably damaging 0.96
Z1176:Kcnh1 UTSW 1 192,101,045 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGACATCCTTCCCCAG -3'
(R):5'- CCTGGATCACCCATAAAGGC -3'

Sequencing Primer
(F):5'- TTCCCCAGTACAAGCAAGAGG -3'
(R):5'- GGCACTAACCTCATCCACGTTC -3'
Posted On 2014-08-25