Incidental Mutation 'R0143:Trim33'
ID22428
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103352101 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1035 (D1035E)
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
Predicted Effect probably benign
Transcript: ENSMUST00000029444
AA Change: D1035E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: D1035E

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106860
AA Change: D1035E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: D1035E

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197365
AA Change: D228E
Predicted Effect probably benign
Transcript: ENSMUST00000198706
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
R8127:Trim33 UTSW 3 103331727 missense possibly damaging 0.66
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF007:Trim33 UTSW 3 103280217 small deletion probably benign
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAACCATTCGAACCAGCATGTATCCT -3'
(R):5'- CCTATTGAACCACATCTCCCTTTGGAAA -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- GCCAATACTCTATAGGTTGGAAGCT -3'
Posted On2013-04-16