Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Ubr1'

224286

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.864) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 120946273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably null
Transcript: ENSMUST00000028728

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133408

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120904042	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120866553	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120925988	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120924134	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120873122	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120947844	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120896519	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120935284	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120904025	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120873146	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120934339	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120901611	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCCTGGCAAAATATCTGTC -3'
(R):5'- TAAAGCCCAGTTGAGAGCCTG -3'

Sequencing Primer
(F):5'- GGCCTGGCAAAATATCTGTCTAAAG -3'
(R):5'- AGTTGAGAGCCTGTCCTCAC -3'

Posted On

2014-08-25