Incidental Mutation 'R2034:Zcchc11'
ID 224303
Institutional Source Beutler Lab
Gene Symbol Zcchc11
Ensembl Gene ENSMUSG00000034610
Gene Name zinc finger, CCHC domain containing 11
Synonyms 6030404K05Rik, 9230115F04Rik
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2034 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 108459426-108559421 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108512195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 651 (R651W)
Ref Sequence ENSEMBL: ENSMUSP00000120172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000155068]
AlphaFold B2RX14
Predicted Effect probably damaging
Transcript: ENSMUST00000043368
AA Change: R690W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610
AA Change: R690W

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 1.2e-13 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 995 1085 4.2e-10 PFAM
Pfam:PAP_assoc 1201 1254 4.7e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1359 1375 3.44e-4 SMART
low complexity region 1398 1412 N/A INTRINSIC
low complexity region 1418 1473 N/A INTRINSIC
low complexity region 1628 1639 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097925
AA Change: R690W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610
AA Change: R690W

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 8e-14 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 994 1082 6.3e-11 PFAM
Pfam:PAP_assoc 1201 1254 5.2e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1364 1380 3.44e-4 SMART
low complexity region 1403 1417 N/A INTRINSIC
low complexity region 1423 1478 N/A INTRINSIC
low complexity region 1632 1643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142835
Predicted Effect probably damaging
Transcript: ENSMUST00000155068
AA Change: R651W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120172
Gene: ENSMUSG00000034610
AA Change: R651W

DomainStartEndE-ValueType
low complexity region 221 236 N/A INTRINSIC
SCOP:d1f5aa2 324 530 2e-23 SMART
Pfam:PAP_assoc 609 662 8.8e-15 PFAM
low complexity region 704 719 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
ZnF_C2HC 892 908 7.79e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Other mutations in Zcchc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zcchc11 APN 4 108550728 missense probably damaging 1.00
IGL00684:Zcchc11 APN 4 108479466 missense possibly damaging 0.80
IGL01598:Zcchc11 APN 4 108550820 unclassified probably benign
IGL01599:Zcchc11 APN 4 108513399 missense possibly damaging 0.85
IGL02088:Zcchc11 APN 4 108512218 splice site probably benign
IGL02451:Zcchc11 APN 4 108529276 nonsense probably null
IGL02667:Zcchc11 APN 4 108558708 splice site probably benign
IGL03080:Zcchc11 APN 4 108505824 missense probably damaging 1.00
IGL03374:Zcchc11 APN 4 108558777 missense probably damaging 1.00
Flatter UTSW 4 108542711 critical splice donor site probably null
Ingratiate UTSW 4 108512195 missense probably damaging 1.00
oedipus UTSW 4 108549355 missense probably damaging 1.00
H8786:Zcchc11 UTSW 4 108550815 critical splice donor site probably null
IGL02799:Zcchc11 UTSW 4 108513528 missense probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0410:Zcchc11 UTSW 4 108486555 missense probably benign 0.27
R0698:Zcchc11 UTSW 4 108555533 missense probably benign 0.22
R0745:Zcchc11 UTSW 4 108502955 splice site probably benign
R1080:Zcchc11 UTSW 4 108479499 missense possibly damaging 0.82
R1774:Zcchc11 UTSW 4 108507955 missense probably damaging 1.00
R1809:Zcchc11 UTSW 4 108549355 missense probably damaging 1.00
R1869:Zcchc11 UTSW 4 108529300 missense probably damaging 1.00
R1874:Zcchc11 UTSW 4 108550725 missense probably damaging 1.00
R1958:Zcchc11 UTSW 4 108555706 missense probably damaging 1.00
R1976:Zcchc11 UTSW 4 108479523 missense probably benign 0.01
R2164:Zcchc11 UTSW 4 108503029 missense possibly damaging 0.73
R2251:Zcchc11 UTSW 4 108520208 missense probably damaging 1.00
R3001:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3002:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3003:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R4170:Zcchc11 UTSW 4 108548059 missense probably damaging 1.00
R4667:Zcchc11 UTSW 4 108495159 missense probably damaging 1.00
R4868:Zcchc11 UTSW 4 108549220 splice site probably benign
R4989:Zcchc11 UTSW 4 108526845 unclassified probably benign
R5014:Zcchc11 UTSW 4 108526846 unclassified probably benign
R5118:Zcchc11 UTSW 4 108520292 missense possibly damaging 0.92
R5431:Zcchc11 UTSW 4 108491412 missense probably damaging 1.00
R5645:Zcchc11 UTSW 4 108557373 missense probably damaging 1.00
R5661:Zcchc11 UTSW 4 108513187 missense probably benign 0.05
R5877:Zcchc11 UTSW 4 108512923 missense probably damaging 0.99
R6307:Zcchc11 UTSW 4 108555620 missense probably damaging 1.00
R6326:Zcchc11 UTSW 4 108478980 missense probably benign 0.02
R6407:Zcchc11 UTSW 4 108558782 missense probably damaging 1.00
R6493:Zcchc11 UTSW 4 108526805 missense probably damaging 1.00
R6587:Zcchc11 UTSW 4 108479449 missense probably benign
R7215:Zcchc11 UTSW 4 108527008 missense probably damaging 1.00
R7413:Zcchc11 UTSW 4 108549336 missense possibly damaging 0.69
R7584:Zcchc11 UTSW 4 108479346 missense probably benign 0.00
R7872:Zcchc11 UTSW 4 108517518 missense probably damaging 1.00
R7970:Zcchc11 UTSW 4 108486454 missense probably benign 0.00
R8214:Zcchc11 UTSW 4 108512150 missense probably benign 0.00
R8297:Zcchc11 UTSW 4 108479708 missense possibly damaging 0.86
R8504:Zcchc11 UTSW 4 108530942 missense probably damaging 1.00
R8514:Zcchc11 UTSW 4 108557357 missense possibly damaging 0.65
R8557:Zcchc11 UTSW 4 108542711 critical splice donor site probably null
R8750:Zcchc11 UTSW 4 108550743 missense probably damaging 1.00
R8805:Zcchc11 UTSW 4 108549378 missense possibly damaging 0.83
R8903:Zcchc11 UTSW 4 108479211 missense probably damaging 1.00
R9003:Zcchc11 UTSW 4 108542832 missense probably damaging 0.98
R9218:Zcchc11 UTSW 4 108512886 nonsense probably null
R9412:Zcchc11 UTSW 4 108557364 missense
Predicted Primers PCR Primer
(F):5'- AAGTGCTTTCTTTATGCCTGAC -3'
(R):5'- TGTGCTTCCCTGATACACAGTC -3'

Sequencing Primer
(F):5'- AATCAGGTACCCTTGGGAC -3'
(R):5'- CCCAAGTGCTGTAATTGCAG -3'
Posted On 2014-08-25