Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Depdc5'

224308

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 32901906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000120902] [ENSMUST00000120902] [ENSMUST00000120902] [ENSMUST00000195980] [ENSMUST00000195980]

AlphaFold

P61460

Predicted Effect

probably null
Transcript: ENSMUST00000049780

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000049780

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000087897

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000087897

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119705

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119705

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120902

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120902

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120902

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120902

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139098

Predicted Effect

probably benign
Transcript: ENSMUST00000195980

SMART Domains

Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	147	4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195980

SMART Domains

Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	147	4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201802

Predicted Effect

probably benign
Transcript: ENSMUST00000201836

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGTGTGTCAGAGCTGCCTTC -3'
(R):5'- TCTAAAATCAGCTGAGGGATGGTG -3'

Sequencing Primer
(F):5'- CTGAGATTAAAAGTGTGAGCCTCCAC -3'
(R):5'- TGATTCCCCAGCAGAAGGC -3'

Posted On

2014-08-25