Incidental Mutation 'R1997:Wdfy3'
ID224310
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 040007-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R1997 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101968946 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 76 (D76G)
Ref Sequence ENSEMBL: ENSMUSP00000134541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
Predicted Effect probably damaging
Transcript: ENSMUST00000053177
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174598
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174698
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: D76G

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212024
AA Change: D76G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7285 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Camsap2 T C 1: 136,271,545 K708E probably damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dhcr7 T G 7: 143,847,430 D446E probably damaging Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Fkbp10 T C 11: 100,416,015 F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kcnh1 G A 1: 192,276,935 V266I probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Sec23a T A 12: 59,002,007 I110L probably benign Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGTCAGTCATCTATGTGGACAGAG -3'
(R):5'- GTCCAGAGGAAATGTCACTGC -3'

Sequencing Primer
(F):5'- TCATCTATGTGGACAGAGAAAGAGC -3'
(R):5'- GGAAATGTCACTGCACTCATG -3'
Posted On2014-08-25