Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Pms2'

224316

Institutional Source

Beutler Lab

Gene Symbol

Pms2

Ensembl Gene

ENSMUSG00000079109

Gene Name

PMS1 homolog2, mismatch repair system component

Synonyms

mismatch repair, DNA mismatch repair

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143909964-143933968 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143913700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 111 (L111P)

Ref Sequence

ENSEMBL: ENSMUSP00000119875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000100483] [ENSMUST00000110709] [ENSMUST00000148011]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031613

SMART Domains

Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610

Domain	Start	End	E-Value	Type
Pfam:AIMP2_LysRS_bd	1	44	8.3e-26	PFAM
low complexity region	133	142	N/A	INTRINSIC
Pfam:GST_C_3	231	308	2.5e-10	PFAM
Pfam:GST_C	242	310	5e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100483

SMART Domains

Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610

Domain	Start	End	E-Value	Type
low complexity region	93	102	N/A	INTRINSIC
Pfam:GST_C_3	185	268	1.1e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110707

Predicted Effect

probably damaging
Transcript: ENSMUST00000110709
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109
AA Change: L111P

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
MutL_C	277	421	1.59e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128153

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128440

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147910

Predicted Effect

probably damaging
Transcript: ENSMUST00000148011
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: L111P

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
DNA_mis_repair	227	364	4.76e-41	SMART
MutL_C	675	819	1.59e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154781

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Pms2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01893:Pms2	APN	5	143923519	missense	probably damaging	1.00
IGL02009:Pms2	APN	5	143925764	missense	probably benign	0.42
IGL02801:Pms2	APN	5	143925835	missense	probably benign	0.06
P0047:Pms2	UTSW	5	143919598	missense	probably damaging	1.00
R1367:Pms2	UTSW	5	143925913	missense	probably damaging	1.00
R1422:Pms2	UTSW	5	143913705	missense	probably damaging	1.00
R1854:Pms2	UTSW	5	143925896	missense	probably benign	0.08
R2248:Pms2	UTSW	5	143916506	missense	probably damaging	1.00
R2873:Pms2	UTSW	5	143911914	splice site	probably benign
R4072:Pms2	UTSW	5	143929001	missense	probably damaging	0.99
R4082:Pms2	UTSW	5	143931019	missense	probably damaging	1.00
R4358:Pms2	UTSW	5	143925926	missense	probably damaging	1.00
R5100:Pms2	UTSW	5	143928188	missense	probably damaging	1.00
R5101:Pms2	UTSW	5	143928188	missense	probably damaging	1.00
R5228:Pms2	UTSW	5	143923597	missense	probably damaging	0.99
R5484:Pms2	UTSW	5	143928125	missense	probably damaging	1.00
R6310:Pms2	UTSW	5	143923583	missense	probably benign	0.06
R6331:Pms2	UTSW	5	143914633	missense	possibly damaging	0.94
R6567:Pms2	UTSW	5	143928968	missense	probably damaging	0.99
R6718:Pms2	UTSW	5	143923489	missense	probably damaging	0.98
R6747:Pms2	UTSW	5	143925419	missense	probably benign	0.02
R6980:Pms2	UTSW	5	143912024	missense	probably benign	0.21
R7207:Pms2	UTSW	5	143913634	missense	probably damaging	1.00
R7349:Pms2	UTSW	5	143925836	missense	probably benign	0.11
R7657:Pms2	UTSW	5	143919539	missense	possibly damaging	0.93
R7820:Pms2	UTSW	5	143914633	missense	possibly damaging	0.80
R7980:Pms2	UTSW	5	143931091	missense	probably damaging	1.00
R8213:Pms2	UTSW	5	143914771	missense	probably damaging	1.00
R8534:Pms2	UTSW	5	143923627	missense	probably benign	0.16
R9021:Pms2	UTSW	5	143925926	missense	probably damaging	1.00
R9218:Pms2	UTSW	5	143931127	missense	probably benign
R9494:Pms2	UTSW	5	143916396	missense	probably damaging	1.00
R9614:Pms2	UTSW	5	143917602	missense	probably benign	0.01
R9712:Pms2	UTSW	5	143914796	missense	probably damaging	0.99
X0064:Pms2	UTSW	5	143916466	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTGTCTCAGATGTTTGAGTAAC -3'
(R):5'- GACAGGCGGTGACTTTTGTAC -3'

Sequencing Primer
(F):5'- TTGAGTAACACTGTCTTACACCACG -3'
(R):5'- CAGGCGGTGACTTTTGTACAACATG -3'

Posted On

2014-08-25