Incidental Mutation 'R2034:Nfe2l3'
ID 224317
Institutional Source Beutler Lab
Gene Symbol Nfe2l3
Ensembl Gene ENSMUSG00000029832
Gene Name nuclear factor, erythroid derived 2, like 3
Synonyms Nrf3
MMRRC Submission 040041-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2034 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 51409650-51435748 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51435350 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 637 (I637V)
Ref Sequence ENSEMBL: ENSMUSP00000005103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005103] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000114459] [ENSMUST00000160133] [ENSMUST00000203220] [ENSMUST00000203954] [ENSMUST00000204158] [ENSMUST00000204188]
AlphaFold Q9WTM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000005103
AA Change: I637V

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005103
Gene: ENSMUSG00000029832
AA Change: I637V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
BRLZ 539 603 3.68e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090002
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114459
SMART Domains Protein: ENSMUSP00000110103
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160133
SMART Domains Protein: ENSMUSP00000124920
Gene: ENSMUSG00000029832

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203220
SMART Domains Protein: ENSMUSP00000145374
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203954
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Predicted Effect probably benign
Transcript: ENSMUST00000204158
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204188
SMART Domains Protein: ENSMUSP00000145245
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,791,385 (GRCm39) I65V probably benign Het
Abca13 A G 11: 9,242,628 (GRCm39) N1497S possibly damaging Het
Afmid C A 11: 117,726,061 (GRCm39) N184K probably benign Het
Ampd2 A T 3: 107,984,679 (GRCm39) I459N possibly damaging Het
Anapc1 T C 2: 128,490,378 (GRCm39) D1018G possibly damaging Het
Ano9 T A 7: 140,688,048 (GRCm39) I223F probably damaging Het
B3gnt6 A G 7: 97,843,225 (GRCm39) L245P possibly damaging Het
Bag6 G A 17: 35,363,668 (GRCm39) R784Q probably damaging Het
Brca1 C G 11: 101,380,675 (GRCm39) S1786T probably benign Het
Btbd3 T G 2: 138,120,903 (GRCm39) S26A probably benign Het
Cacna1d C A 14: 29,811,820 (GRCm39) V1277L probably damaging Het
Casp12 C T 9: 5,346,491 (GRCm39) T6I probably damaging Het
Col7a1 T C 9: 108,792,075 (GRCm39) V1262A unknown Het
Crh C A 3: 19,748,262 (GRCm39) G127C probably damaging Het
D5Ertd579e A T 5: 36,770,882 (GRCm39) L64* probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Ddc T A 11: 11,830,456 (GRCm39) I63L probably benign Het
Eif3a C T 19: 60,750,568 (GRCm39) probably benign Het
Fsip2 T A 2: 82,819,838 (GRCm39) N5190K probably benign Het
Gm5420 A G 10: 21,567,512 (GRCm39) noncoding transcript Het
Grb14 A G 2: 64,753,873 (GRCm39) probably benign Het
Gsap A T 5: 21,475,593 (GRCm39) I545F probably damaging Het
Hectd1 A T 12: 51,803,899 (GRCm39) probably null Het
Helz2 G A 2: 180,874,371 (GRCm39) P2041L probably damaging Het
Herc1 G A 9: 66,349,254 (GRCm39) A2038T probably benign Het
Il10 C A 1: 130,951,922 (GRCm39) Q152K probably benign Het
Klrg1 A G 6: 122,256,596 (GRCm39) probably null Het
Lrig2 T C 3: 104,401,408 (GRCm39) T160A probably benign Het
Mmd2 A T 5: 142,560,939 (GRCm39) probably null Het
Mmp2 C T 8: 93,563,540 (GRCm39) S338F probably damaging Het
Nalcn T G 14: 123,521,015 (GRCm39) D1630A probably benign Het
Ncoa2 T C 1: 13,235,207 (GRCm39) S909G probably benign Het
Neb A T 2: 52,170,623 (GRCm39) M1683K possibly damaging Het
Npw G A 17: 24,877,242 (GRCm39) S53F probably damaging Het
Nrbf2 A T 10: 67,111,343 (GRCm39) probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nup188 T A 2: 30,200,097 (GRCm39) probably benign Het
Or4k15c T C 14: 50,321,440 (GRCm39) M233V probably benign Het
Or5b21 T A 19: 12,839,151 (GRCm39) M4K possibly damaging Het
Parp4 A T 14: 56,871,720 (GRCm39) I1133F probably damaging Het
Pcdhb11 T C 18: 37,555,546 (GRCm39) V292A probably benign Het
Pcnx2 A G 8: 126,545,406 (GRCm39) probably null Het
Phf2 A G 13: 48,971,206 (GRCm39) S489P unknown Het
Pik3r5 T A 11: 68,384,403 (GRCm39) N598K probably damaging Het
Pikfyve A T 1: 65,261,516 (GRCm39) E432D probably damaging Het
Pink1 T C 4: 138,045,343 (GRCm39) I274V possibly damaging Het
Pkhd1 G A 1: 20,270,893 (GRCm39) T3220I probably damaging Het
Plxna2 A G 1: 194,462,902 (GRCm39) I890V probably benign Het
Pomgnt1 T C 4: 116,015,124 (GRCm39) V492A possibly damaging Het
Prp2 G T 6: 132,572,947 (GRCm39) probably null Het
Rabl6 T C 2: 25,475,444 (GRCm39) E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 (GRCm39) probably null Het
Rps6kb2 T C 19: 4,211,106 (GRCm39) T140A probably damaging Het
S100a11 T C 3: 93,433,429 (GRCm39) I91T probably benign Het
Serpine2 A G 1: 79,774,569 (GRCm39) L230P probably damaging Het
Sh3tc2 A G 18: 62,120,737 (GRCm39) D370G probably damaging Het
Sim2 A C 16: 93,886,801 (GRCm39) I43L probably damaging Het
Skp2 C A 15: 9,113,786 (GRCm39) G376C probably damaging Het
Slc14a2 A G 18: 78,226,798 (GRCm39) L419P probably damaging Het
Srgap1 C T 10: 121,628,651 (GRCm39) E817K probably damaging Het
Stag3 A G 5: 138,296,263 (GRCm39) E442G possibly damaging Het
Sulf1 A G 1: 12,890,645 (GRCm39) N361S probably damaging Het
Tmco6 A G 18: 36,870,909 (GRCm39) probably null Het
Tmem104 T A 11: 115,134,373 (GRCm39) I303N probably benign Het
Ttll6 G T 11: 96,026,352 (GRCm39) D86Y probably damaging Het
Tut4 C T 4: 108,369,392 (GRCm39) R651W probably damaging Het
Vmn1r120 T G 7: 20,786,883 (GRCm39) E276A possibly damaging Het
Vmn1r64 A G 7: 5,886,988 (GRCm39) M185T probably benign Het
Vmn2r85 A T 10: 130,262,242 (GRCm39) probably benign Het
Vwa3a A T 7: 120,381,868 (GRCm39) K568* probably null Het
Other mutations in Nfe2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02705:Nfe2l3 APN 6 51,410,098 (GRCm39) missense probably damaging 0.96
IGL02803:Nfe2l3 APN 6 51,434,291 (GRCm39) missense possibly damaging 0.50
R0277:Nfe2l3 UTSW 6 51,434,448 (GRCm39) missense probably benign 0.30
R0693:Nfe2l3 UTSW 6 51,410,034 (GRCm39) missense possibly damaging 0.94
R1397:Nfe2l3 UTSW 6 51,410,274 (GRCm39) missense probably benign 0.00
R1455:Nfe2l3 UTSW 6 51,434,744 (GRCm39) missense possibly damaging 0.91
R1541:Nfe2l3 UTSW 6 51,434,585 (GRCm39) missense probably damaging 0.98
R1753:Nfe2l3 UTSW 6 51,410,392 (GRCm39) missense probably null 0.96
R1946:Nfe2l3 UTSW 6 51,434,295 (GRCm39) missense probably damaging 1.00
R3807:Nfe2l3 UTSW 6 51,434,357 (GRCm39) nonsense probably null
R3932:Nfe2l3 UTSW 6 51,433,595 (GRCm39) missense possibly damaging 0.94
R4271:Nfe2l3 UTSW 6 51,433,614 (GRCm39) missense probably damaging 0.99
R4604:Nfe2l3 UTSW 6 51,427,992 (GRCm39) missense probably damaging 0.99
R4816:Nfe2l3 UTSW 6 51,433,604 (GRCm39) missense probably damaging 0.99
R5765:Nfe2l3 UTSW 6 51,434,226 (GRCm39) missense probably damaging 1.00
R5893:Nfe2l3 UTSW 6 51,434,832 (GRCm39) missense probably damaging 1.00
R7378:Nfe2l3 UTSW 6 51,434,276 (GRCm39) nonsense probably null
R7490:Nfe2l3 UTSW 6 51,434,524 (GRCm39) missense possibly damaging 0.65
R7624:Nfe2l3 UTSW 6 51,435,252 (GRCm39) missense probably damaging 1.00
R8210:Nfe2l3 UTSW 6 51,428,065 (GRCm39) missense probably benign 0.00
R8678:Nfe2l3 UTSW 6 51,435,153 (GRCm39) missense possibly damaging 0.54
R9071:Nfe2l3 UTSW 6 51,434,243 (GRCm39) missense probably benign 0.01
R9146:Nfe2l3 UTSW 6 51,410,172 (GRCm39) missense probably damaging 0.99
R9625:Nfe2l3 UTSW 6 51,434,925 (GRCm39) missense probably damaging 0.99
Z1177:Nfe2l3 UTSW 6 51,410,277 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGCTCAGAACTGCCGTAAAC -3'
(R):5'- GGATTCTCCCAACTTCACAGAAG -3'

Sequencing Primer
(F):5'- GAACTGCCGTAAACGTAAACTAG -3'
(R):5'- CTTCACAGAAGCATAATCTTGATTCC -3'
Posted On 2014-08-25