Incidental Mutation 'R2034:Mmp2'
ID224333
Institutional Source Beutler Lab
Gene Symbol Mmp2
Ensembl Gene ENSMUSG00000031740
Gene Namematrix metallopeptidase 2
Synonymsgelatinase A, 72kDa gelatinase, Clg4a, GelA, MMP-2, 72kDa type IV collagenase
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location92827291-92853420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92836912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 338 (S338F)
Ref Sequence ENSEMBL: ENSMUSP00000034187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034187]
Predicted Effect probably damaging
Transcript: ENSMUST00000034187
AA Change: S338F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034187
Gene: ENSMUSG00000031740
AA Change: S338F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:PG_binding_1 43 97 2.4e-9 PFAM
ZnMc 115 447 1.06e-49 SMART
FN2 226 274 2.88e-25 SMART
FN2 284 332 5.17e-27 SMART
FN2 342 390 3.33e-30 SMART
HX 477 520 1.13e-4 SMART
HX 522 565 1.33e-10 SMART
HX 570 617 2.21e-16 SMART
HX 619 662 4.29e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211691
Meta Mutation Damage Score 0.2702 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that hydrolyzes collagens, gelatins, laminin, fibronectin and elastin. Mice lacking the encoded protein exhibit suppressed angiogenesis and attenuated features of human multicentric osteolysis with arthritis including abnormal skeletal and craniofacial development. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit slightly delayed growth, reduced neovascularization, retarded tumor progression, an exaggerated asthma response to allergens, and impaired branching morphogenesis of the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Mmp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Mmp2 APN 8 92830684 missense probably benign
IGL02165:Mmp2 APN 8 92833219 missense probably null 1.00
IGL02424:Mmp2 APN 8 92836007 missense probably damaging 1.00
IGL02478:Mmp2 APN 8 92852607 missense possibly damaging 0.50
IGL03351:Mmp2 APN 8 92839342 missense probably benign 0.00
R2012:Mmp2 UTSW 8 92850203 missense probably benign 0.00
R2079:Mmp2 UTSW 8 92850189 missense probably damaging 1.00
R5090:Mmp2 UTSW 8 92852574 missense probably damaging 1.00
R5103:Mmp2 UTSW 8 92831785 nonsense probably null
R5357:Mmp2 UTSW 8 92833152 missense possibly damaging 0.73
R6902:Mmp2 UTSW 8 92836917 missense probably damaging 0.97
R6925:Mmp2 UTSW 8 92839382 missense probably damaging 1.00
R7057:Mmp2 UTSW 8 92831705 missense probably damaging 1.00
R7229:Mmp2 UTSW 8 92831786 missense probably damaging 1.00
R7316:Mmp2 UTSW 8 92840410 missense probably benign
R7332:Mmp2 UTSW 8 92850152 missense probably damaging 1.00
R7397:Mmp2 UTSW 8 92836127 missense possibly damaging 0.91
R7549:Mmp2 UTSW 8 92836966 missense probably null 1.00
R7585:Mmp2 UTSW 8 92836936 missense probably damaging 1.00
R7694:Mmp2 UTSW 8 92831730 missense possibly damaging 0.76
R7814:Mmp2 UTSW 8 92850170 missense probably benign 0.03
X0065:Mmp2 UTSW 8 92827739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCTATCTACAAGGGTCC -3'
(R):5'- TCCAGTGTCTCTACCCAAAGGC -3'

Sequencing Primer
(F):5'- AGACTCTGAACTATGGCTACCTGG -3'
(R):5'- CCAGGGCCTCATACCTTGGTC -3'
Posted On2014-08-25