Mutagenetix > Incidental Mutations

Incidental Mutation 'R2034:Pcnx2'

224335

Institutional Source

Beutler Lab

Gene Symbol

Pcnx2

Ensembl Gene

ENSMUSG00000060212

Gene Name

pecanex homolog 2

Synonyms

Pcnxl2, E330039K12Rik

MMRRC Submission

040041-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2034 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125751508-125898317 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 125818667 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000042294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000047239]

Predicted Effect

probably null
Transcript: ENSMUST00000047239

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047239

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120589

SMART Domains

Protein: ENSMUSP00000113111
Gene: ENSMUSG00000060212

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Pecanex_C	533	762	4e-122	PFAM
low complexity region	797	822	N/A	INTRINSIC
low complexity region	901	914	N/A	INTRINSIC
low complexity region	937	952	N/A	INTRINSIC

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,900,559	I65V	probably benign	Het
Abca13	A	G	11: 9,292,628	N1497S	possibly damaging	Het
Afmid	C	A	11: 117,835,235	N184K	probably benign	Het
Ampd2	A	T	3: 108,077,363	I459N	possibly damaging	Het
Anapc1	T	C	2: 128,648,458	D1018G	possibly damaging	Het
Ano9	T	A	7: 141,108,135	I223F	probably damaging	Het
B3gnt6	A	G	7: 98,194,018	L245P	possibly damaging	Het
Bag6	G	A	17: 35,144,692	R784Q	probably damaging	Het
Brca1	C	G	11: 101,489,849	S1786T	probably benign	Het
Btbd3	T	G	2: 138,278,983	S26A	probably benign	Het
Cacna1d	C	A	14: 30,089,863	V1277L	probably damaging	Het
Casp12	C	T	9: 5,346,491	T6I	probably damaging	Het
Col7a1	T	C	9: 108,963,007	V1262A	unknown	Het
Crh	C	A	3: 19,694,098	G127C	probably damaging	Het
D5Ertd579e	A	T	5: 36,613,538	L64*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddc	T	A	11: 11,880,456	I63L	probably benign	Het
Eif3a	C	T	19: 60,762,130		probably benign	Het
Fsip2	T	A	2: 82,989,494	N5190K	probably benign	Het
Gm5420	A	G	10: 21,691,613		noncoding transcript	Het
Grb14	A	G	2: 64,923,529		probably benign	Het
Gsap	A	T	5: 21,270,595	I545F	probably damaging	Het
Hectd1	A	T	12: 51,757,116		probably null	Het
Helz2	G	A	2: 181,232,578	P2041L	probably damaging	Het
Herc1	G	A	9: 66,441,972	A2038T	probably benign	Het
Il10	C	A	1: 131,024,185	Q152K	probably benign	Het
Klrg1	A	G	6: 122,279,637		probably null	Het
Lrig2	T	C	3: 104,494,092	T160A	probably benign	Het
Mmd2	A	T	5: 142,575,184		probably null	Het
Mmp2	C	T	8: 92,836,912	S338F	probably damaging	Het
Nalcn	T	G	14: 123,283,603	D1630A	probably benign	Het
Ncoa2	T	C	1: 13,164,983	S909G	probably benign	Het
Neb	A	T	2: 52,280,611	M1683K	possibly damaging	Het
Nfe2l3	A	G	6: 51,458,370	I637V	possibly damaging	Het
Npw	G	A	17: 24,658,268	S53F	probably damaging	Het
Nrbf2	A	T	10: 67,275,564		probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Nup188	T	A	2: 30,310,085		probably benign	Het
Olfr1444	T	A	19: 12,861,787	M4K	possibly damaging	Het
Olfr726	T	C	14: 50,083,983	M233V	probably benign	Het
Parp4	A	T	14: 56,634,263	I1133F	probably damaging	Het
Pcdhb11	T	C	18: 37,422,493	V292A	probably benign	Het
Phf2	A	G	13: 48,817,730	S489P	unknown	Het
Pik3r5	T	A	11: 68,493,577	N598K	probably damaging	Het
Pikfyve	A	T	1: 65,222,357	E432D	probably damaging	Het
Pink1	T	C	4: 138,318,032	I274V	possibly damaging	Het
Pkhd1	G	A	1: 20,200,669	T3220I	probably damaging	Het
Plxna2	A	G	1: 194,780,594	I890V	probably benign	Het
Pomgnt1	T	C	4: 116,157,927	V492A	possibly damaging	Het
Prp2	G	T	6: 132,595,984		probably null	Het
Rabl6	T	C	2: 25,585,432	E543G	possibly damaging	Het
Rgp1	T	A	4: 43,581,605		probably null	Het
Rps6kb2	T	C	19: 4,161,107	T140A	probably damaging	Het
S100a11	T	C	3: 93,526,122	I91T	probably benign	Het
Serpine2	A	G	1: 79,796,852	L230P	probably damaging	Het
Sh3tc2	A	G	18: 61,987,666	D370G	probably damaging	Het
Sim2	A	C	16: 94,085,942	I43L	probably damaging	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc14a2	A	G	18: 78,183,583	L419P	probably damaging	Het
Srgap1	C	T	10: 121,792,746	E817K	probably damaging	Het
Stag3	A	G	5: 138,298,001	E442G	possibly damaging	Het
Sulf1	A	G	1: 12,820,421	N361S	probably damaging	Het
Tmco6	A	G	18: 36,737,856		probably null	Het
Tmem104	T	A	11: 115,243,547	I303N	probably benign	Het
Ttll6	G	T	11: 96,135,526	D86Y	probably damaging	Het
Vmn1r120	T	G	7: 21,052,958	E276A	possibly damaging	Het
Vmn1r64	A	G	7: 5,883,989	M185T	probably benign	Het
Vmn2r85	A	T	10: 130,426,373		probably benign	Het
Vwa3a	A	T	7: 120,782,645	K568*	probably null	Het
Zcchc11	C	T	4: 108,512,195	R651W	probably damaging	Het

Other mutations in Pcnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcnx2	APN	8	125887585	missense	probably damaging	1.00
IGL00900:Pcnx2	APN	8	125863236	splice site	probably benign
IGL01134:Pcnx2	APN	8	125863150	missense	probably benign
IGL01370:Pcnx2	APN	8	125801483	missense	probably damaging	0.96
IGL01452:Pcnx2	APN	8	125838032	missense	probably damaging	1.00
IGL01477:Pcnx2	APN	8	125785305	missense	probably damaging	1.00
IGL01610:Pcnx2	APN	8	125839633	missense	possibly damaging	0.67
IGL01640:Pcnx2	APN	8	125801558	missense	probably benign	0.14
IGL01645:Pcnx2	APN	8	125887917	missense	probably damaging	1.00
IGL01876:Pcnx2	APN	8	125866031	missense	probably benign	0.31
IGL01933:Pcnx2	APN	8	125761654	missense	probably damaging	1.00
IGL02208:Pcnx2	APN	8	125752155	missense	probably benign	0.30
IGL02573:Pcnx2	APN	8	125855273	missense	probably benign	0.34
IGL02810:Pcnx2	APN	8	125887203	missense	probably benign	0.03
IGL02859:Pcnx2	APN	8	125863173	missense	probably damaging	1.00
IGL02879:Pcnx2	APN	8	125772057	missense	probably damaging	1.00
IGL03202:Pcnx2	APN	8	125772044	missense	probably damaging	0.98
IGL03259:Pcnx2	APN	8	125753649	missense	probably benign	0.19
IGL03395:Pcnx2	APN	8	125887523	missense	probably benign	0.00
IGL03410:Pcnx2	APN	8	125887040	missense	probably damaging	1.00
gallen	UTSW	8	125891120	missense	probably damaging	1.00
hotzone	UTSW	8	125891141	missense	probably benign	0.00
R0107:Pcnx2	UTSW	8	125753586	missense	probably benign	0.29
R0477:Pcnx2	UTSW	8	125761567	missense	probably damaging	0.99
R0610:Pcnx2	UTSW	8	125839687	missense	probably damaging	1.00
R0645:Pcnx2	UTSW	8	125760720	missense	possibly damaging	0.64
R0894:Pcnx2	UTSW	8	125886926	splice site	probably benign
R1083:Pcnx2	UTSW	8	125772104	missense	probably damaging	1.00
R1199:Pcnx2	UTSW	8	125887314	missense	possibly damaging	0.60
R1296:Pcnx2	UTSW	8	125773833	missense	probably damaging	1.00
R1445:Pcnx2	UTSW	8	125752284	missense	probably damaging	0.99
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1524:Pcnx2	UTSW	8	125891141	missense	probably benign	0.00
R1537:Pcnx2	UTSW	8	125877449	missense	possibly damaging	0.94
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1593:Pcnx2	UTSW	8	125759273	missense	probably benign	0.11
R1598:Pcnx2	UTSW	8	125772086	missense	probably benign	0.03
R1603:Pcnx2	UTSW	8	125839626	missense	probably damaging	1.00
R1697:Pcnx2	UTSW	8	125850348	missense	probably damaging	1.00
R1759:Pcnx2	UTSW	8	125773978	missense	probably damaging	1.00
R1855:Pcnx2	UTSW	8	125807996	splice site	probably benign
R1863:Pcnx2	UTSW	8	125818786	missense	probably damaging	0.98
R1930:Pcnx2	UTSW	8	125887714	missense	probably benign	0.10
R1967:Pcnx2	UTSW	8	125815683	missense	possibly damaging	0.51
R1974:Pcnx2	UTSW	8	125887371	missense	probably benign	0.00
R1998:Pcnx2	UTSW	8	125887143	missense	probably damaging	1.00
R2072:Pcnx2	UTSW	8	125761742	missense	possibly damaging	0.90
R2096:Pcnx2	UTSW	8	125759248	missense	probably benign	0.27
R2216:Pcnx2	UTSW	8	125888077	missense	probably benign	0.00
R2290:Pcnx2	UTSW	8	125877595	splice site	probably benign
R2373:Pcnx2	UTSW	8	125753451	missense	probably damaging	1.00
R2484:Pcnx2	UTSW	8	125891120	missense	probably damaging	1.00
R2849:Pcnx2	UTSW	8	125760927	missense	probably damaging	1.00
R2891:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2892:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2970:Pcnx2	UTSW	8	125801536	missense	probably damaging	1.00
R3013:Pcnx2	UTSW	8	125887770	missense	probably benign	0.05
R3608:Pcnx2	UTSW	8	125888101	missense	probably benign
R3876:Pcnx2	UTSW	8	125888158	missense	probably benign
R4349:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4352:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4353:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4361:Pcnx2	UTSW	8	125768298	nonsense	probably null
R4735:Pcnx2	UTSW	8	125828041	critical splice donor site	probably null
R4749:Pcnx2	UTSW	8	125887588	missense	probably damaging	1.00
R4812:Pcnx2	UTSW	8	125865939	missense	probably benign	0.00
R4819:Pcnx2	UTSW	8	125855230	missense	probably benign	0.04
R4829:Pcnx2	UTSW	8	125861058	intron	probably null
R4832:Pcnx2	UTSW	8	125752188	missense	probably damaging	0.99
R4876:Pcnx2	UTSW	8	125772108	missense	probably damaging	1.00
R4974:Pcnx2	UTSW	8	125851130	missense	probably benign	0.00
R5057:Pcnx2	UTSW	8	125855191	missense	possibly damaging	0.95
R5078:Pcnx2	UTSW	8	125752156	missense	probably benign
R5114:Pcnx2	UTSW	8	125838010	missense	possibly damaging	0.89
R5195:Pcnx2	UTSW	8	125801549	missense	possibly damaging	0.69
R5239:Pcnx2	UTSW	8	125861082	intron	probably null
R5348:Pcnx2	UTSW	8	125818756	missense	probably damaging	1.00
R5398:Pcnx2	UTSW	8	125887948	missense	possibly damaging	0.63
R5448:Pcnx2	UTSW	8	125888149	missense	probably benign	0.14
R5534:Pcnx2	UTSW	8	125838015	missense	possibly damaging	0.65
R5624:Pcnx2	UTSW	8	125761523	critical splice donor site	probably null
R5629:Pcnx2	UTSW	8	125898041	missense	probably damaging	1.00
R5630:Pcnx2	UTSW	8	125860958	missense	probably damaging	0.99
R5782:Pcnx2	UTSW	8	125753484	missense	probably damaging	1.00
R5877:Pcnx2	UTSW	8	125753728	missense	probably damaging	0.99
R5879:Pcnx2	UTSW	8	125773946	missense	probably damaging	1.00
R6114:Pcnx2	UTSW	8	125773947	missense	probably damaging	1.00
R6152:Pcnx2	UTSW	8	125753752	missense	probably damaging	0.99
R6154:Pcnx2	UTSW	8	125762813	missense	probably damaging	1.00
R6283:Pcnx2	UTSW	8	125877586	missense	probably damaging	0.99
R6500:Pcnx2	UTSW	8	125753485	missense	probably damaging	1.00
R6629:Pcnx2	UTSW	8	125891112	missense	probably benign	0.00
R6708:Pcnx2	UTSW	8	125860953	critical splice donor site	probably null
R6736:Pcnx2	UTSW	8	125752317	splice site	probably null
R6748:Pcnx2	UTSW	8	125850335	missense	probably damaging	1.00
R6788:Pcnx2	UTSW	8	125772100	missense	probably damaging	1.00
R6849:Pcnx2	UTSW	8	125861210	missense	probably damaging	1.00
R6947:Pcnx2	UTSW	8	125850282	critical splice donor site	probably null
R7034:Pcnx2	UTSW	8	125785302	missense	probably damaging	1.00
R7100:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R7124:Pcnx2	UTSW	8	125753617	missense	probably damaging	0.99
R7130:Pcnx2	UTSW	8	125753584	nonsense	probably null
R7133:Pcnx2	UTSW	8	125801504	missense	probably benign	0.01
R7271:Pcnx2	UTSW	8	125886951	missense	probably benign
R7326:Pcnx2	UTSW	8	125887083	missense	probably damaging	1.00
R7373:Pcnx2	UTSW	8	125808027	missense	probably damaging	1.00
R7397:Pcnx2	UTSW	8	125890885	intron	probably null
R7662:Pcnx2	UTSW	8	125818771	nonsense	probably null
R7693:Pcnx2	UTSW	8	125887125	missense	probably benign	0.09
R7726:Pcnx2	UTSW	8	125850330	missense	probably benign	0.00
R7745:Pcnx2	UTSW	8	125851107	missense	probably benign	0.04
R7792:Pcnx2	UTSW	8	125892018	missense	possibly damaging	0.63
R7797:Pcnx2	UTSW	8	125785348	missense	possibly damaging	0.70
RF018:Pcnx2	UTSW	8	125877519	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125826928	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125866018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGGGCAGATCAAACTTGG -3'
(R):5'- ACTTGTCTGTGAGAGCCTCTAC -3'

Sequencing Primer
(F):5'- AACTTGGTTTGCATTCCTGTCTAAG -3'
(R):5'- TCTGTGAGAGCCTCTACTCAGAG -3'

Posted On

2014-08-25