Incidental Mutation 'R0143:Ncf1'
ID22434
Institutional Source Beutler Lab
Gene Symbol Ncf1
Ensembl Gene ENSMUSG00000015950
Gene Nameneutrophil cytosolic factor 1
Synonymsp47, Ncf-1, NOXO2, NADPH oxidase subunit (47kDa), p47phox
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134220053-134229625 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 134227137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354]
Predicted Effect probably benign
Transcript: ENSMUST00000016094
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111275
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139249
Predicted Effect probably benign
Transcript: ENSMUST00000144086
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146354
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182626
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes severe spontaneous infections and granulomatous inflammation and may alter synaptic plasticity and memory, RAS activation, blood pressure control, airway smooth muscle function, neointima formation, vasoconstriction and the response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Ncf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ncf1 APN 5 134226593 missense probably benign 0.03
IGL02718:Ncf1 APN 5 134227448 critical splice donor site probably null
R0313:Ncf1 UTSW 5 134229567 start codon destroyed probably null 1.00
R0413:Ncf1 UTSW 5 134222802 splice site probably benign
R2037:Ncf1 UTSW 5 134229552 missense probably damaging 1.00
R2042:Ncf1 UTSW 5 134226640 missense probably benign 0.00
R2511:Ncf1 UTSW 5 134225698 missense probably damaging 0.99
R3545:Ncf1 UTSW 5 134226609 nonsense probably null
R3547:Ncf1 UTSW 5 134226609 nonsense probably null
R3548:Ncf1 UTSW 5 134226609 nonsense probably null
R4751:Ncf1 UTSW 5 134229545 missense probably damaging 1.00
R4989:Ncf1 UTSW 5 134223413 missense probably damaging 0.98
R5288:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5384:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5385:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5590:Ncf1 UTSW 5 134223501 missense probably damaging 0.98
R6059:Ncf1 UTSW 5 134223487 missense probably damaging 1.00
R6136:Ncf1 UTSW 5 134226633 missense probably damaging 1.00
R7023:Ncf1 UTSW 5 134225262 missense possibly damaging 0.48
R7310:Ncf1 UTSW 5 134221761 missense probably benign 0.04
R7618:Ncf1 UTSW 5 134227267 missense probably benign 0.08
R7838:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGCCTCATGGTGACATGGACCTG -3'
(R):5'- ATGCTGAAGGAGATGTTCCCCATTG -3'

Sequencing Primer
(F):5'- ACATGGACCTGTGTAGATGC -3'
(R):5'- ATGTTCCCCATTGAGGCCG -3'
Posted On2013-04-16