Incidental Mutation 'R1997:Nav2'
ID 224340
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, Unc53H2, 5330421F07Rik, POMFIL2, HELAD1, RAINB2
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.550) question?
Stock # R1997 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 48608796-49259838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49198219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1283 (S1283T)
Ref Sequence ENSEMBL: ENSMUSP00000139045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect probably benign
Transcript: ENSMUST00000064395
AA Change: S1283T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: S1283T

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
AA Change: S1222T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: S1222T

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184109
AA Change: S94T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512
AA Change: S94T

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: S1283T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: S1283T

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,220,942 (GRCm39) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,102,269 (GRCm39) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,225,477 (GRCm39) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,220,957 (GRCm39) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,243,977 (GRCm39) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,208,521 (GRCm39) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,102,260 (GRCm39) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,195,789 (GRCm39) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,232,623 (GRCm39) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,214,843 (GRCm39) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,070,004 (GRCm39) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,198,171 (GRCm39) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,114,627 (GRCm39) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,111,756 (GRCm39) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,011,847 (GRCm39) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,141,205 (GRCm39) nonsense probably null
R0006:Nav2 UTSW 7 49,102,978 (GRCm39) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,220,462 (GRCm39) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,185,701 (GRCm39) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,195,651 (GRCm39) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,254,333 (GRCm39) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,111,686 (GRCm39) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,058,431 (GRCm39) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,070,081 (GRCm39) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,233,901 (GRCm39) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,185,788 (GRCm39) splice site probably benign
R1274:Nav2 UTSW 7 49,254,178 (GRCm39) nonsense probably null
R1463:Nav2 UTSW 7 49,185,710 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,195,682 (GRCm39) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,220,959 (GRCm39) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,102,213 (GRCm39) missense probably benign
R1731:Nav2 UTSW 7 49,197,922 (GRCm39) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,225,468 (GRCm39) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,197,943 (GRCm39) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,114,620 (GRCm39) missense probably damaging 1.00
R2061:Nav2 UTSW 7 49,248,645 (GRCm39) splice site probably benign
R2117:Nav2 UTSW 7 49,114,328 (GRCm39) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,102,411 (GRCm39) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,247,002 (GRCm39) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,103,025 (GRCm39) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,141,152 (GRCm39) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,248,565 (GRCm39) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,058,632 (GRCm39) missense probably benign
R2568:Nav2 UTSW 7 49,247,312 (GRCm39) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,195,690 (GRCm39) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,114,310 (GRCm39) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,195,606 (GRCm39) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,246,979 (GRCm39) missense probably damaging 1.00
R4207:Nav2 UTSW 7 49,222,046 (GRCm39) splice site probably null
R4411:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4413:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,225,011 (GRCm39) splice site probably benign
R4440:Nav2 UTSW 7 49,201,785 (GRCm39) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,198,292 (GRCm39) splice site probably null
R4729:Nav2 UTSW 7 49,102,567 (GRCm39) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,058,749 (GRCm39) intron probably benign
R4887:Nav2 UTSW 7 49,198,182 (GRCm39) nonsense probably null
R4908:Nav2 UTSW 7 49,254,258 (GRCm39) missense probably damaging 1.00
R4952:Nav2 UTSW 7 48,954,288 (GRCm39) intron probably benign
R4965:Nav2 UTSW 7 49,202,625 (GRCm39) nonsense probably null
R5169:Nav2 UTSW 7 49,198,231 (GRCm39) nonsense probably null
R5224:Nav2 UTSW 7 49,201,473 (GRCm39) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,185,661 (GRCm39) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,197,982 (GRCm39) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,058,440 (GRCm39) small deletion probably benign
R5320:Nav2 UTSW 7 49,141,121 (GRCm39) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,238,908 (GRCm39) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,197,917 (GRCm39) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,206,794 (GRCm39) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,197,817 (GRCm39) splice site probably null
R5884:Nav2 UTSW 7 49,246,917 (GRCm39) nonsense probably null
R5921:Nav2 UTSW 7 48,954,324 (GRCm39) intron probably benign
R6180:Nav2 UTSW 7 49,107,915 (GRCm39) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,213,851 (GRCm39) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,102,923 (GRCm39) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,244,114 (GRCm39) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,247,281 (GRCm39) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,244,100 (GRCm39) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,114,652 (GRCm39) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,201,664 (GRCm39) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,107,917 (GRCm39) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,141,204 (GRCm39) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,070,076 (GRCm39) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,111,672 (GRCm39) missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49,198,037 (GRCm39) missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49,201,521 (GRCm39) missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49,203,951 (GRCm39) splice site probably null
R7451:Nav2 UTSW 7 49,202,577 (GRCm39) splice site probably null
R7545:Nav2 UTSW 7 49,232,605 (GRCm39) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,244,067 (GRCm39) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,222,145 (GRCm39) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,246,921 (GRCm39) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,237,525 (GRCm39) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,201,698 (GRCm39) nonsense probably null
R8119:Nav2 UTSW 7 49,103,232 (GRCm39) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,204,009 (GRCm39) critical splice donor site probably null
R8306:Nav2 UTSW 7 49,195,765 (GRCm39) missense probably benign 0.33
R8331:Nav2 UTSW 7 49,102,371 (GRCm39) missense probably benign
R8402:Nav2 UTSW 7 49,103,185 (GRCm39) missense probably benign 0.43
R8421:Nav2 UTSW 7 49,102,269 (GRCm39) missense probably benign
R8478:Nav2 UTSW 7 49,111,733 (GRCm39) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,141,184 (GRCm39) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,102,320 (GRCm39) missense probably benign
R8835:Nav2 UTSW 7 49,248,551 (GRCm39) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,111,705 (GRCm39) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,220,964 (GRCm39) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,208,561 (GRCm39) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,254,293 (GRCm39) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,202,599 (GRCm39) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,246,904 (GRCm39) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,197,647 (GRCm39) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,243,971 (GRCm39) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,102,509 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TAACATGAGCAGCAAGTCGG -3'
(R):5'- TTTCCCATCCTGGCATGGAAG -3'

Sequencing Primer
(F):5'- AGCAAGTCGGCAGGCCTG -3'
(R):5'- AGCAGAGTACAGACCCGTCG -3'
Posted On 2014-08-25