Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Nav2'

224340

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.545) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49548471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1283 (S1283T)

Ref Sequence

ENSEMBL: ENSMUSP00000139045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]

AlphaFold

E9Q842

Predicted Effect

probably benign
Transcript: ENSMUST00000064395
AA Change: S1283T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: S1283T

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183659
AA Change: S1222T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: S1222T

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184109
AA Change: S94T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512
AA Change: S94T

Domain	Start	End	E-Value	Type
low complexity region	154	171	N/A	INTRINSIC
low complexity region	179	196	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184945
AA Change: S1283T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: S1283T

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8110:Nav2	UTSW	7	49551950	nonsense	probably null
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
R8835:Nav2	UTSW	7	49598803	missense	possibly damaging	0.83
R8933:Nav2	UTSW	7	49461957	missense	probably damaging	1.00
R8957:Nav2	UTSW	7	49571216	missense	probably damaging	1.00
R9069:Nav2	UTSW	7	49558813	missense	probably damaging	0.99
R9095:Nav2	UTSW	7	49604545	missense	probably damaging	1.00
R9223:Nav2	UTSW	7	49552851	missense	probably damaging	1.00
R9261:Nav2	UTSW	7	49597156	missense	probably damaging	1.00
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAACATGAGCAGCAAGTCGG -3'
(R):5'- TTTCCCATCCTGGCATGGAAG -3'

Sequencing Primer
(F):5'- AGCAAGTCGGCAGGCCTG -3'
(R):5'- AGCAGAGTACAGACCCGTCG -3'

Posted On

2014-08-25