Incidental Mutation 'R2034:Col7a1'
ID224341
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108963007 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1262 (V1262A)
Ref Sequence ENSEMBL: ENSMUSP00000107701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: V1262A
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: V1262A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: V1262A
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: V1262A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127905
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
R7556:Col7a1 UTSW 9 108982465 splice site probably null
R7571:Col7a1 UTSW 9 108982707 missense probably null
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Predicted Primers PCR Primer
(F):5'- AGAGGTTTGGAGAAGGCCTC -3'
(R):5'- CTGTAAGCCAGGCACAAGAG -3'

Sequencing Primer
(F):5'- TTAGAACTTCCTGGTCTCAAGGAGC -3'
(R):5'- CCAGGCACAAGAGAGGCAG -3'
Posted On2014-08-25