Incidental Mutation 'R1997:Dhcr7'
ID224352
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 040007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1997 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 143847430 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 446 (D446E)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: D443E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: D443E

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: D443E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: D443E

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: D443E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: D443E

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: D446E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Camsap2 T C 1: 136,271,545 K708E probably damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Fkbp10 T C 11: 100,416,015 F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kcnh1 G A 1: 192,276,935 V266I probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Sec23a T A 12: 59,002,007 I110L probably benign Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143841227 missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1473:Dhcr7 UTSW 7 143847068 missense probably damaging 0.99
R1769:Dhcr7 UTSW 7 143847513 missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R2302:Dhcr7 UTSW 7 143837892 missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143837839 missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143845490 missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143845472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCCTACACATCAGCTG -3'
(R):5'- TCCAGATGAGCAAACTGAGG -3'

Sequencing Primer
(F):5'- TGATGGGCTGAAGCACCAC -3'
(R):5'- ACTGAGGAGGCAGTTTGC -3'
Posted On2014-08-25