Incidental Mutation 'R1997:Dhcr7'
ID 224352
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1997 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 143401167 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 446 (D446E)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
AlphaFold O88455
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: D443E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: D443E

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: D443E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: D443E

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: D443E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: D443E

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: D446E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGCTCCTACACATCAGCTG -3'
(R):5'- TCCAGATGAGCAAACTGAGG -3'

Sequencing Primer
(F):5'- TGATGGGCTGAAGCACCAC -3'
(R):5'- ACTGAGGAGGCAGTTTGC -3'
Posted On 2014-08-25