Mutagenetix > Incidental Mutation

Incidental Mutation 'R2034:Brca1'

224361

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

040041-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2034 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 101489849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1786 (S1786T)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

AlphaFold

P48754

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: S1786T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: S1786T

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,900,559	I65V	probably benign	Het
Abca13	A	G	11: 9,292,628	N1497S	possibly damaging	Het
Afmid	C	A	11: 117,835,235	N184K	probably benign	Het
Ampd2	A	T	3: 108,077,363	I459N	possibly damaging	Het
Anapc1	T	C	2: 128,648,458	D1018G	possibly damaging	Het
Ano9	T	A	7: 141,108,135	I223F	probably damaging	Het
B3gnt6	A	G	7: 98,194,018	L245P	possibly damaging	Het
Bag6	G	A	17: 35,144,692	R784Q	probably damaging	Het
Btbd3	T	G	2: 138,278,983	S26A	probably benign	Het
Cacna1d	C	A	14: 30,089,863	V1277L	probably damaging	Het
Casp12	C	T	9: 5,346,491	T6I	probably damaging	Het
Col7a1	T	C	9: 108,963,007	V1262A	unknown	Het
Crh	C	A	3: 19,694,098	G127C	probably damaging	Het
D5Ertd579e	A	T	5: 36,613,538	L64*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddc	T	A	11: 11,880,456	I63L	probably benign	Het
Eif3a	C	T	19: 60,762,130		probably benign	Het
Fsip2	T	A	2: 82,989,494	N5190K	probably benign	Het
Gm5420	A	G	10: 21,691,613		noncoding transcript	Het
Grb14	A	G	2: 64,923,529		probably benign	Het
Gsap	A	T	5: 21,270,595	I545F	probably damaging	Het
Hectd1	A	T	12: 51,757,116		probably null	Het
Helz2	G	A	2: 181,232,578	P2041L	probably damaging	Het
Herc1	G	A	9: 66,441,972	A2038T	probably benign	Het
Il10	C	A	1: 131,024,185	Q152K	probably benign	Het
Klrg1	A	G	6: 122,279,637		probably null	Het
Lrig2	T	C	3: 104,494,092	T160A	probably benign	Het
Mmd2	A	T	5: 142,575,184		probably null	Het
Mmp2	C	T	8: 92,836,912	S338F	probably damaging	Het
Nalcn	T	G	14: 123,283,603	D1630A	probably benign	Het
Ncoa2	T	C	1: 13,164,983	S909G	probably benign	Het
Neb	A	T	2: 52,280,611	M1683K	possibly damaging	Het
Nfe2l3	A	G	6: 51,458,370	I637V	possibly damaging	Het
Npw	G	A	17: 24,658,268	S53F	probably damaging	Het
Nrbf2	A	T	10: 67,275,564		probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Nup188	T	A	2: 30,310,085		probably benign	Het
Olfr1444	T	A	19: 12,861,787	M4K	possibly damaging	Het
Olfr726	T	C	14: 50,083,983	M233V	probably benign	Het
Parp4	A	T	14: 56,634,263	I1133F	probably damaging	Het
Pcdhb11	T	C	18: 37,422,493	V292A	probably benign	Het
Pcnx2	A	G	8: 125,818,667		probably null	Het
Phf2	A	G	13: 48,817,730	S489P	unknown	Het
Pik3r5	T	A	11: 68,493,577	N598K	probably damaging	Het
Pikfyve	A	T	1: 65,222,357	E432D	probably damaging	Het
Pink1	T	C	4: 138,318,032	I274V	possibly damaging	Het
Pkhd1	G	A	1: 20,200,669	T3220I	probably damaging	Het
Plxna2	A	G	1: 194,780,594	I890V	probably benign	Het
Pomgnt1	T	C	4: 116,157,927	V492A	possibly damaging	Het
Prp2	G	T	6: 132,595,984		probably null	Het
Rabl6	T	C	2: 25,585,432	E543G	possibly damaging	Het
Rgp1	T	A	4: 43,581,605		probably null	Het
Rps6kb2	T	C	19: 4,161,107	T140A	probably damaging	Het
S100a11	T	C	3: 93,526,122	I91T	probably benign	Het
Serpine2	A	G	1: 79,796,852	L230P	probably damaging	Het
Sh3tc2	A	G	18: 61,987,666	D370G	probably damaging	Het
Sim2	A	C	16: 94,085,942	I43L	probably damaging	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc14a2	A	G	18: 78,183,583	L419P	probably damaging	Het
Srgap1	C	T	10: 121,792,746	E817K	probably damaging	Het
Stag3	A	G	5: 138,298,001	E442G	possibly damaging	Het
Sulf1	A	G	1: 12,820,421	N361S	probably damaging	Het
Tmco6	A	G	18: 36,737,856		probably null	Het
Tmem104	T	A	11: 115,243,547	I303N	probably benign	Het
Ttll6	G	T	11: 96,135,526	D86Y	probably damaging	Het
Vmn1r120	T	G	7: 21,052,958	E276A	possibly damaging	Het
Vmn1r64	A	G	7: 5,883,989	M185T	probably benign	Het
Vmn2r85	A	T	10: 130,426,373		probably benign	Het
Vwa3a	A	T	7: 120,782,645	K568*	probably null	Het
Zcchc11	C	T	4: 108,512,195	R651W	probably damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCACATAGGTAGAAGCTGG -3'
(R):5'- TGGGCTTTTACCACGCTCAC -3'

Sequencing Primer
(F):5'- CACATAGGTAGAAGCTGGTTTTTCC -3'
(R):5'- CACTCCTTTGGCTTTTGAATAAGG -3'

Posted On

2014-08-25