Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Nbeal2'

224364

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R1997 (G1)

Quality Score

114

Status

Not validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110632198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1599 (H1599R)

Ref Sequence

ENSEMBL: ENSMUSP00000128586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000123996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126088

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129095

Predicted Effect

unknown
Transcript: ENSMUST00000130024
AA Change: H880R

SMART Domains

Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: H880R

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	236	248	N/A	INTRINSIC
Pfam:DUF4704	345	607	2.5e-29	PFAM
low complexity region	649	664	N/A	INTRINSIC
low complexity region	804	819	N/A	INTRINSIC
Pfam:DUF4800	872	1138	9.9e-113	PFAM
low complexity region	1164	1193	N/A	INTRINSIC
Pfam:PH_BEACH	1204	1291	2.2e-21	PFAM
Beach	1343	1623	5.2e-205	SMART
WD40	1721	1766	1.03e1	SMART
WD40	1769	1808	6.19e-5	SMART
WD40	1820	1859	1.02e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131017

SMART Domains

Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
Pfam:DUF4800	1	209	7.5e-97	PFAM
low complexity region	235	264	N/A	INTRINSIC
Pfam:PH_BEACH	275	362	1e-21	PFAM
Beach	414	694	5.2e-205	SMART
WD40	762	807	1.03e1	SMART
WD40	810	849	6.19e-5	SMART
WD40	861	900	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133191
AA Change: H1592R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: H1592R

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153960

Predicted Effect

probably damaging
Transcript: ENSMUST00000167320
AA Change: H1599R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: H1599R

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184024

Predicted Effect

probably damaging
Transcript: ENSMUST00000196488
AA Change: H1565R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: H1565R

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
Antonym	UTSW	9	110630252	missense	probably damaging	1.00
Beowulf	UTSW	9	110637937	missense	possibly damaging	0.65
Blackmail	UTSW	9	110629639	missense	probably damaging	1.00
dog	UTSW	9	110635341	missense	possibly damaging	0.89
extortion	UTSW	9	110630243	missense	probably damaging	1.00
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	splice site	probably null
Schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
Sophomoric	UTSW	9	110633047	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0310:Nbeal2	UTSW	9	110638163	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1519:Nbeal2	UTSW	9	110636305	missense	probably damaging	1.00
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2113:Nbeal2	UTSW	9	110625406	missense	probably damaging	1.00
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R4991:Nbeal2	UTSW	9	110638767	missense	probably damaging	1.00
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6191:Nbeal2	UTSW	9	110627990	critical splice donor site	probably null
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7099:Nbeal2	UTSW	9	110645438	splice site	probably null
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
R7902:Nbeal2	UTSW	9	110637547	missense	probably benign
R7923:Nbeal2	UTSW	9	110631446	nonsense	probably null
R8018:Nbeal2	UTSW	9	110629157	unclassified	probably benign
R8190:Nbeal2	UTSW	9	110626090	missense	probably benign	0.04
R8297:Nbeal2	UTSW	9	110635341	missense	possibly damaging	0.89
R8404:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
R8502:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
R8737:Nbeal2	UTSW	9	110627881	missense	probably damaging	1.00
R8782:Nbeal2	UTSW	9	110630805	missense	probably benign	0.04
R8807:Nbeal2	UTSW	9	110629639	missense	probably damaging	1.00
R8877:Nbeal2	UTSW	9	110630243	missense	probably damaging	1.00
R9057:Nbeal2	UTSW	9	110627150	missense	probably benign
R9267:Nbeal2	UTSW	9	110633047	missense	probably damaging	1.00
R9313:Nbeal2	UTSW	9	110634368	missense	probably damaging	1.00
R9352:Nbeal2	UTSW	9	110627848	missense	probably benign	0.03
R9482:Nbeal2	UTSW	9	110633998	missense	probably benign	0.25
R9533:Nbeal2	UTSW	9	110644661	missense	probably benign	0.01
R9566:Nbeal2	UTSW	9	110628921	missense	probably benign	0.00
R9769:Nbeal2	UTSW	9	110626279	missense	probably benign	0.01
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51
Z1176:Nbeal2	UTSW	9	110625816	missense	probably benign	0.01
Z1176:Nbeal2	UTSW	9	110638835	missense	probably benign
Z1177:Nbeal2	UTSW	9	110629854	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCAAAGAAGGTGGGGCTTC -3'
(R):5'- ATAGCACAGCAGATCTCCGG -3'

Sequencing Primer
(F):5'- ATATGCACGGTCCAGCAG -3'
(R):5'- ATCTCCGGGAGATGGCG -3'

Posted On

2014-08-25