Incidental Mutation 'R1997:Nbeal2'
ID 224364
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Name neurobeachin-like 2
Synonyms 1110014F23Rik
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R1997 (G1)
Quality Score 114
Status Not validated
Chromosome 9
Chromosomal Location 110453857-110483229 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110461266 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1599 (H1599R)
Ref Sequence ENSEMBL: ENSMUSP00000128586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129095
Predicted Effect unknown
Transcript: ENSMUST00000130024
AA Change: H880R
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: H880R

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131017
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133191
AA Change: H1592R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: H1592R

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167320
AA Change: H1599R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: H1599R

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196488
AA Change: H1565R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: H1565R

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184024
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110,464,937 (GRCm39) missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110,458,831 (GRCm39) splice site probably benign
IGL00826:Nbeal2 APN 9 110,455,971 (GRCm39) missense probably benign
IGL00885:Nbeal2 APN 9 110,467,729 (GRCm39) missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110,458,214 (GRCm39) missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110,458,302 (GRCm39) missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110,461,826 (GRCm39) missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110,473,746 (GRCm39) missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110,460,482 (GRCm39) missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110,456,392 (GRCm39) missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110,455,063 (GRCm39) nonsense probably null
IGL02483:Nbeal2 APN 9 110,455,063 (GRCm39) nonsense probably null
IGL02502:Nbeal2 APN 9 110,462,836 (GRCm39) missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110,459,276 (GRCm39) missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110,455,045 (GRCm39) missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110,468,353 (GRCm39) splice site probably benign
IGL02887:Nbeal2 APN 9 110,457,344 (GRCm39) missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110,468,360 (GRCm39) critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110,460,501 (GRCm39) missense probably damaging 1.00
Antonym UTSW 9 110,459,320 (GRCm39) missense probably damaging 1.00
Beowulf UTSW 9 110,467,005 (GRCm39) missense possibly damaging 0.65
Blackmail UTSW 9 110,458,707 (GRCm39) missense probably damaging 1.00
dog UTSW 9 110,464,409 (GRCm39) missense possibly damaging 0.89
extortion UTSW 9 110,459,311 (GRCm39) missense probably damaging 1.00
legion UTSW 9 110,458,247 (GRCm39) missense probably damaging 1.00
litigious UTSW 9 110,457,263 (GRCm39) missense probably damaging 1.00
mall UTSW 9 110,461,954 (GRCm39) missense probably damaging 1.00
Mollusca UTSW 9 110,474,506 (GRCm39) splice site probably null
Schleuter UTSW 9 110,457,812 (GRCm39) missense possibly damaging 0.69
shellfish UTSW 9 110,457,788 (GRCm39) missense probably damaging 1.00
Sophomoric UTSW 9 110,462,115 (GRCm39) missense probably damaging 1.00
F5770:Nbeal2 UTSW 9 110,467,005 (GRCm39) missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110,466,936 (GRCm39) splice site probably benign
R0084:Nbeal2 UTSW 9 110,472,778 (GRCm39) critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110,471,211 (GRCm39) nonsense probably null
R0294:Nbeal2 UTSW 9 110,461,927 (GRCm39) missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110,467,231 (GRCm39) missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110,456,255 (GRCm39) missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110,471,226 (GRCm39) missense probably benign 0.01
R0630:Nbeal2 UTSW 9 110,465,102 (GRCm39) splice site probably benign
R0762:Nbeal2 UTSW 9 110,472,876 (GRCm39) splice site probably benign
R0862:Nbeal2 UTSW 9 110,457,263 (GRCm39) missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110,457,263 (GRCm39) missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110,461,954 (GRCm39) missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110,456,176 (GRCm39) missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110,462,740 (GRCm39) splice site probably benign
R1519:Nbeal2 UTSW 9 110,465,373 (GRCm39) missense probably damaging 1.00
R1655:Nbeal2 UTSW 9 110,461,940 (GRCm39) missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110,467,961 (GRCm39) missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110,454,264 (GRCm39) missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110,459,925 (GRCm39) nonsense probably null
R1834:Nbeal2 UTSW 9 110,456,197 (GRCm39) missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110,463,139 (GRCm39) missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110,463,139 (GRCm39) missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110,464,375 (GRCm39) missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110,463,139 (GRCm39) missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110,454,474 (GRCm39) missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110,467,376 (GRCm39) missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110,459,318 (GRCm39) missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110,455,638 (GRCm39) missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110,459,876 (GRCm39) missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110,457,136 (GRCm39) missense possibly damaging 0.82
R3052:Nbeal2 UTSW 9 110,462,153 (GRCm39) missense possibly damaging 0.93
R3076:Nbeal2 UTSW 9 110,460,768 (GRCm39) missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110,465,955 (GRCm39) splice site probably benign
R3974:Nbeal2 UTSW 9 110,462,914 (GRCm39) missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110,465,743 (GRCm39) missense probably benign
R4342:Nbeal2 UTSW 9 110,460,861 (GRCm39) intron probably benign
R4654:Nbeal2 UTSW 9 110,461,072 (GRCm39) missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110,461,123 (GRCm39) missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110,465,383 (GRCm39) missense possibly damaging 0.82
R4854:Nbeal2 UTSW 9 110,460,464 (GRCm39) missense probably damaging 1.00
R4860:Nbeal2 UTSW 9 110,464,262 (GRCm39) missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110,464,262 (GRCm39) missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110,463,871 (GRCm39) missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110,467,835 (GRCm39) missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110,466,531 (GRCm39) missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110,460,073 (GRCm39) missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110,455,796 (GRCm39) splice site probably null
R5161:Nbeal2 UTSW 9 110,458,936 (GRCm39) missense probably benign
R5202:Nbeal2 UTSW 9 110,473,734 (GRCm39) missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110,461,158 (GRCm39) missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110,466,588 (GRCm39) missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110,460,801 (GRCm39) missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110,460,560 (GRCm39) missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110,458,948 (GRCm39) missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110,470,945 (GRCm39) missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110,454,215 (GRCm39) missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110,457,058 (GRCm39) critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110,467,802 (GRCm39) missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110,457,812 (GRCm39) missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110,455,062 (GRCm39) missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110,473,526 (GRCm39) missense probably benign
R6648:Nbeal2 UTSW 9 110,466,710 (GRCm39) missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110,462,060 (GRCm39) missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110,465,973 (GRCm39) missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110,455,176 (GRCm39) missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110,468,459 (GRCm39) missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110,467,686 (GRCm39) missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110,467,686 (GRCm39) missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110,457,788 (GRCm39) missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110,455,119 (GRCm39) missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110,455,177 (GRCm39) missense probably damaging 0.99
R7099:Nbeal2 UTSW 9 110,474,506 (GRCm39) splice site probably null
R7354:Nbeal2 UTSW 9 110,458,247 (GRCm39) missense probably damaging 1.00
R7394:Nbeal2 UTSW 9 110,459,257 (GRCm39) critical splice donor site probably null
R7397:Nbeal2 UTSW 9 110,457,100 (GRCm39) missense possibly damaging 0.78
R7552:Nbeal2 UTSW 9 110,482,985 (GRCm39) missense probably benign 0.16
R7619:Nbeal2 UTSW 9 110,454,886 (GRCm39) missense probably benign 0.19
R7821:Nbeal2 UTSW 9 110,459,320 (GRCm39) missense probably damaging 1.00
R7902:Nbeal2 UTSW 9 110,466,615 (GRCm39) missense probably benign
R7923:Nbeal2 UTSW 9 110,460,514 (GRCm39) nonsense probably null
R8018:Nbeal2 UTSW 9 110,458,225 (GRCm39) unclassified probably benign
R8190:Nbeal2 UTSW 9 110,455,158 (GRCm39) missense probably benign 0.04
R8297:Nbeal2 UTSW 9 110,464,409 (GRCm39) missense possibly damaging 0.89
R8404:Nbeal2 UTSW 9 110,463,457 (GRCm39) missense possibly damaging 0.48
R8502:Nbeal2 UTSW 9 110,463,457 (GRCm39) missense possibly damaging 0.48
R8737:Nbeal2 UTSW 9 110,456,949 (GRCm39) missense probably damaging 1.00
R8782:Nbeal2 UTSW 9 110,459,873 (GRCm39) missense probably benign 0.04
R8807:Nbeal2 UTSW 9 110,458,707 (GRCm39) missense probably damaging 1.00
R8877:Nbeal2 UTSW 9 110,459,311 (GRCm39) missense probably damaging 1.00
R9057:Nbeal2 UTSW 9 110,456,218 (GRCm39) missense probably benign
R9267:Nbeal2 UTSW 9 110,462,115 (GRCm39) missense probably damaging 1.00
R9313:Nbeal2 UTSW 9 110,463,436 (GRCm39) missense probably damaging 1.00
R9352:Nbeal2 UTSW 9 110,456,916 (GRCm39) missense probably benign 0.03
R9482:Nbeal2 UTSW 9 110,463,066 (GRCm39) missense probably benign 0.25
R9533:Nbeal2 UTSW 9 110,473,729 (GRCm39) missense probably benign 0.01
R9566:Nbeal2 UTSW 9 110,457,989 (GRCm39) missense probably benign 0.00
R9769:Nbeal2 UTSW 9 110,455,347 (GRCm39) missense probably benign 0.01
V7583:Nbeal2 UTSW 9 110,467,005 (GRCm39) missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110,473,346 (GRCm39) missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110,473,481 (GRCm39) splice site probably benign
Z1088:Nbeal2 UTSW 9 110,461,440 (GRCm39) missense possibly damaging 0.51
Z1176:Nbeal2 UTSW 9 110,467,903 (GRCm39) missense probably benign
Z1176:Nbeal2 UTSW 9 110,454,884 (GRCm39) missense probably benign 0.01
Z1177:Nbeal2 UTSW 9 110,458,922 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAAAGAAGGTGGGGCTTC -3'
(R):5'- ATAGCACAGCAGATCTCCGG -3'

Sequencing Primer
(F):5'- ATATGCACGGTCCAGCAG -3'
(R):5'- ATCTCCGGGAGATGGCG -3'
Posted On 2014-08-25