Incidental Mutation 'R2034:Afmid'
ID 224365
Institutional Source Beutler Lab
Gene Symbol Afmid
Ensembl Gene ENSMUSG00000017718
Gene Name arylformamidase
Synonyms 9030621K19Rik, formylkynureninase, formylase, kynurenine formamidase, Kf
MMRRC Submission 040041-MU
Accession Numbers

Genbank: NM_027827; MGI: 2448704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2034 (G1)
Quality Score 98
Status Validated
Chromosome 11
Chromosomal Location 117825924-117839908 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 117835235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 184 (N184K)
Ref Sequence ENSEMBL: ENSMUSP00000073102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073388] [ENSMUST00000132298] [ENSMUST00000149668]
AlphaFold Q8K4H1
Predicted Effect probably benign
Transcript: ENSMUST00000073388
AA Change: N184K

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073102
Gene: ENSMUSG00000017718
AA Change: N184K

DomainStartEndE-ValueType
Pfam:COesterase 34 139 1.1e-6 PFAM
Pfam:Abhydrolase_5 88 280 4.1e-12 PFAM
Pfam:Abhydrolase_3 89 283 7.8e-19 PFAM
Pfam:Peptidase_S9 106 296 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131268
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148016
Predicted Effect probably benign
Transcript: ENSMUST00000149668
AA Change: N176K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119310
Gene: ENSMUSG00000017718
AA Change: N176K

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 80 272 9.1e-12 PFAM
Pfam:Abhydrolase_3 81 273 1.7e-17 PFAM
Pfam:Peptidase_S9 101 287 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153850
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit polydipsia, polyuria and hyperglycemia. Mice homozygous for a full exon 2 deletion show impaired glucose tolerance due to reduced insulin secretion associated with reduced islet mass. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(12)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Afmid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Afmid APN 11 117836426 missense probably damaging 0.99
IGL02205:Afmid APN 11 117835156 missense probably damaging 1.00
IGL02657:Afmid APN 11 117834822 missense possibly damaging 0.72
2107:Afmid UTSW 11 117835561 missense probably damaging 1.00
R0371:Afmid UTSW 11 117835140 splice site probably benign
R0907:Afmid UTSW 11 117835590 splice site probably benign
R0941:Afmid UTSW 11 117835245 splice site probably benign
R1915:Afmid UTSW 11 117835799 missense possibly damaging 0.96
R1975:Afmid UTSW 11 117836474 missense probably benign 0.07
R4064:Afmid UTSW 11 117836528 missense probably benign 0.00
R5386:Afmid UTSW 11 117828142 missense probably benign
R5815:Afmid UTSW 11 117835704 missense probably benign 0.17
R7075:Afmid UTSW 11 117835705 missense probably benign
R7185:Afmid UTSW 11 117834773 missense possibly damaging 0.66
R8016:Afmid UTSW 11 117835544 missense probably benign 0.00
R8835:Afmid UTSW 11 117828088 missense probably benign 0.14
R9023:Afmid UTSW 11 117835523 missense probably damaging 0.99
R9028:Afmid UTSW 11 117836663 missense probably benign 0.00
Z1176:Afmid UTSW 11 117834966 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCAAGCAATGAGTAGGTGTC -3'
(R):5'- GCAAAGAAGGGTCTCCTCTACTC -3'

Sequencing Primer
(F):5'- CTCACGGATGCTTTCAGGGAG -3'
(R):5'- GAAGGGTCTCCTCTACTCAAGTTATC -3'
Posted On 2014-08-25