Incidental Mutation 'R1997:Fkbp10'
ID224380
Institutional Source Beutler Lab
Gene Symbol Fkbp10
Ensembl Gene ENSMUSG00000001555
Gene NameFK506 binding protein 10
SynonymsFkbp6, Fkbp-rs1, Fkbp1-rs, FKBP65, 65kDa
MMRRC Submission 040007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1997 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100415697-100424824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100416015 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 78 (F78L)
Ref Sequence ENSEMBL: ENSMUSP00000103023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001595] [ENSMUST00000066489] [ENSMUST00000107400]
Predicted Effect probably damaging
Transcript: ENSMUST00000001595
AA Change: F78L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001595
Gene: ENSMUSG00000001555
AA Change: F78L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 5.4e-30 PFAM
Pfam:FKBP_C 166 258 4e-29 PFAM
Pfam:FKBP_C 278 370 2.3e-28 PFAM
Pfam:FKBP_C 391 482 6.2e-26 PFAM
EFh 503 528 2.16e0 SMART
EFh 545 573 2.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066489
SMART Domains Protein: ENSMUSP00000065278
Gene: ENSMUSG00000006931

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
internal_repeat_1 151 215 5.16e-8 PROSPERO
internal_repeat_1 302 364 5.16e-8 PROSPERO
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107400
AA Change: F78L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103023
Gene: ENSMUSG00000001555
AA Change: F78L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 1.4e-29 PFAM
Pfam:FKBP_C 166 258 2e-29 PFAM
Pfam:FKBP_C 279 370 4.9e-26 PFAM
EFh 391 416 2.16e0 SMART
EFh 433 461 2.04e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000134815
AA Change: F57L
SMART Domains Protein: ENSMUSP00000123577
Gene: ENSMUSG00000001555
AA Change: F57L

DomainStartEndE-ValueType
Pfam:FKBP_C 34 65 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139084
Predicted Effect probably benign
Transcript: ENSMUST00000141840
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice do not survive birth, and embryos exhibit delayed growth, tissue fragility, decreased aorta wall thickness, craniofacial and forelimb anomalies, and connective tissue alterations. Mutant MEFs retain procollagen in the cell layer and show dilated endoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Camsap2 T C 1: 136,271,545 K708E probably damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dhcr7 T G 7: 143,847,430 D446E probably damaging Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kcnh1 G A 1: 192,276,935 V266I probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Sec23a T A 12: 59,002,007 I110L probably benign Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Fkbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fkbp10 APN 11 100421817 missense probably benign 0.00
IGL02390:Fkbp10 APN 11 100416017 missense probably damaging 1.00
IGL02424:Fkbp10 APN 11 100415956 missense probably damaging 1.00
IGL02728:Fkbp10 APN 11 100415977 missense probably damaging 1.00
IGL02737:Fkbp10 APN 11 100422655 missense probably benign 0.25
IGL03143:Fkbp10 APN 11 100422754 missense probably benign 0.06
R0479:Fkbp10 UTSW 11 100415914 missense probably damaging 1.00
R1733:Fkbp10 UTSW 11 100423931 missense probably benign 0.20
R1817:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1819:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1831:Fkbp10 UTSW 11 100423219 missense probably damaging 1.00
R2017:Fkbp10 UTSW 11 100421673 missense possibly damaging 0.77
R3758:Fkbp10 UTSW 11 100422625 critical splice acceptor site probably null
R5163:Fkbp10 UTSW 11 100423099 missense probably benign 0.03
R5437:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R5666:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5696:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5698:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5706:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R7084:Fkbp10 UTSW 11 100421303 missense possibly damaging 0.56
R7405:Fkbp10 UTSW 11 100415881 missense probably damaging 1.00
R7780:Fkbp10 UTSW 11 100421222 missense probably damaging 1.00
R8237:Fkbp10 UTSW 11 100415959 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACTGCCGTTGCTGTTGC -3'
(R):5'- CTGAGCATCAAATATTCCAGGGG -3'

Sequencing Primer
(F):5'- TTGCTTCTACAGACCTTGGAG -3'
(R):5'- CATCAAATATTCCAGGGGGCTAG -3'
Posted On2014-08-25