Incidental Mutation 'R2034:Nrros'
ID224383
Institutional Source Beutler Lab
Gene Symbol Nrros
Ensembl Gene ENSMUSG00000052384
Gene Namenegative regulator of reactive oxygen species
SynonymsLrrc33, E430025L02Rik
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32142785-32165594 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 32144157 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 311 (W311*)
Ref Sequence ENSEMBL: ENSMUSP00000155965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099991] [ENSMUST00000115163] [ENSMUST00000115165] [ENSMUST00000126869] [ENSMUST00000130410] [ENSMUST00000143682] [ENSMUST00000144345] [ENSMUST00000231836]
Predicted Effect probably null
Transcript: ENSMUST00000099991
AA Change: W319*
SMART Domains Protein: ENSMUSP00000097571
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115163
AA Change: W347*
SMART Domains Protein: ENSMUSP00000110817
Gene: ENSMUSG00000052384
AA Change: W347*

DomainStartEndE-ValueType
LRRNT 59 89 1.05e1 SMART
LRR 108 131 1.01e2 SMART
LRR 159 183 5.27e1 SMART
LRR 184 207 4.05e-1 SMART
LRR_TYP 208 231 7.67e-2 SMART
LRR 232 255 1.49e1 SMART
LRR_TYP 355 378 1.67e-2 SMART
LRR 404 428 3.27e1 SMART
LRR_TYP 429 452 1.79e-2 SMART
LRR 489 512 1.45e1 SMART
LRR 563 584 1.76e1 SMART
LRR 587 608 3.36e1 SMART
transmembrane domain 681 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115165
AA Change: W295*
SMART Domains Protein: ENSMUSP00000110819
Gene: ENSMUSG00000052384
AA Change: W295*

DomainStartEndE-ValueType
Blast:LRRNT 8 37 5e-8 BLAST
LRR 56 79 1.01e2 SMART
LRR 107 131 5.27e1 SMART
LRR 132 155 4.05e-1 SMART
LRR_TYP 156 179 7.67e-2 SMART
LRR 180 203 1.49e1 SMART
LRR_TYP 303 326 1.67e-2 SMART
LRR 352 376 3.27e1 SMART
LRR_TYP 377 400 1.79e-2 SMART
LRR 437 460 1.45e1 SMART
LRR 511 532 1.76e1 SMART
LRR 535 556 3.36e1 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126869
AA Change: W319*
SMART Domains Protein: ENSMUSP00000116388
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127287
Predicted Effect probably benign
Transcript: ENSMUST00000130410
SMART Domains Protein: ENSMUSP00000122290
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Pfam:LRR_7 81 97 1.9e-2 PFAM
Pfam:LRR_7 105 121 6.8e-2 PFAM
Pfam:LRR_7 133 144 2e-1 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136809
Predicted Effect probably null
Transcript: ENSMUST00000143682
AA Change: W319*
SMART Domains Protein: ENSMUSP00000119349
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144345
SMART Domains Protein: ENSMUSP00000121492
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150250
Predicted Effect probably null
Transcript: ENSMUST00000231836
AA Change: W311*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased oxidative stress and susceptibility to experimental autoimmune encephalomyelitis, but to reduced susceptibility to bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Nrros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Nrros APN 16 32147620 missense probably benign 0.06
IGL01097:Nrros APN 16 32144185 missense possibly damaging 0.71
IGL02065:Nrros APN 16 32144674 missense possibly damaging 0.84
IGL03372:Nrros APN 16 32144770 missense probably damaging 1.00
R0615:Nrros UTSW 16 32144085 missense probably damaging 1.00
R0669:Nrros UTSW 16 32143423 missense probably damaging 1.00
R0840:Nrros UTSW 16 32143423 missense probably damaging 1.00
R1398:Nrros UTSW 16 32143144 missense probably damaging 0.98
R1796:Nrros UTSW 16 32143511 missense probably damaging 1.00
R2031:Nrros UTSW 16 32144157 nonsense probably null
R2033:Nrros UTSW 16 32144157 nonsense probably null
R2087:Nrros UTSW 16 32144157 nonsense probably null
R2089:Nrros UTSW 16 32144157 nonsense probably null
R2090:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2151:Nrros UTSW 16 32143258 missense probably benign 0.11
R2438:Nrros UTSW 16 32144111 unclassified probably null
R2438:Nrros UTSW 16 32144299 missense probably benign 0.25
R5474:Nrros UTSW 16 32144352 missense probably benign 0.00
R5527:Nrros UTSW 16 32144470 missense probably damaging 1.00
R5629:Nrros UTSW 16 32144405 missense probably damaging 1.00
R5888:Nrros UTSW 16 32143087 missense probably benign 0.15
R5939:Nrros UTSW 16 32143454 missense probably benign 0.01
R5982:Nrros UTSW 16 32144593 missense probably damaging 0.96
R6869:Nrros UTSW 16 32144431 missense probably damaging 1.00
R6912:Nrros UTSW 16 32162239 missense probably null 0.01
R7010:Nrros UTSW 16 32143580 missense probably damaging 0.96
R7469:Nrros UTSW 16 32144212 missense probably benign 0.14
R7673:Nrros UTSW 16 32162281 missense unknown
R7770:Nrros UTSW 16 32143528 missense probably benign 0.01
X0022:Nrros UTSW 16 32143040 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTGGTTGTGGCTCAGATCC -3'
(R):5'- TACTGGACCTGTCTCACAACC -3'

Sequencing Primer
(F):5'- GTTGTGGCTCAGATCCAGCTC -3'
(R):5'- TGTCTCACAACCAGCTGC -3'
Posted On2014-08-25