Incidental Mutation 'R2034:Sim2'
ID 224385
Institutional Source Beutler Lab
Gene Symbol Sim2
Ensembl Gene ENSMUSG00000062713
Gene Name single-minded family bHLH transcription factor 2
Synonyms bHLHe15
MMRRC Submission 040041-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2034 (G1)
Quality Score 163
Status Validated
Chromosome 16
Chromosomal Location 94084931-94127032 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 94085942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 43 (I43L)
Ref Sequence ENSEMBL: ENSMUSP00000072043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072182] [ENSMUST00000231688]
AlphaFold Q61079
Predicted Effect probably damaging
Transcript: ENSMUST00000072182
AA Change: I43L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072043
Gene: ENSMUSG00000062713
AA Change: I43L

DomainStartEndE-ValueType
HLH 6 58 6.99e-5 SMART
PAS 79 145 7.8e-13 SMART
PAS 220 286 1.31e-5 SMART
PAC 292 335 2.44e-5 SMART
Pfam:SIM_C 358 650 4.5e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231688
AA Change: I43L

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231710
Meta Mutation Damage Score 0.4538 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a homolog of the Drosophila single-minded (sim) gene, which encodes a transcription factor that is a master regulator of neurogenesis. The encoded protein is ubiquitinated by RING-IBR-RING-type E3 ubiquitin ligases, including the parkin RBR E3 ubiquitin protein ligase. This gene maps within the so-called Down syndrome chromosomal region, and is thus thought to contribute to some specific Down syndrome phenotypes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, cleft palate, malformed pterygoid processes, and aerophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Sim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sim2 APN 16 94114944 nonsense probably null
IGL01329:Sim2 APN 16 94106260 missense possibly damaging 0.64
IGL01965:Sim2 APN 16 94121178 missense probably benign 0.20
IGL01979:Sim2 APN 16 94123482 missense possibly damaging 0.81
IGL02821:Sim2 APN 16 94097188 missense probably damaging 1.00
IGL03027:Sim2 APN 16 94109492 splice site probably benign
P0027:Sim2 UTSW 16 94109422 missense probably benign 0.02
PIT4696001:Sim2 UTSW 16 94094309 missense possibly damaging 0.49
R1836:Sim2 UTSW 16 94123577 critical splice donor site probably null
R4085:Sim2 UTSW 16 94109354 missense possibly damaging 0.48
R4475:Sim2 UTSW 16 94125791 missense probably benign
R4476:Sim2 UTSW 16 94125791 missense probably benign
R4647:Sim2 UTSW 16 94123526 missense possibly damaging 0.71
R4919:Sim2 UTSW 16 94109335 missense probably benign 0.01
R4966:Sim2 UTSW 16 94123421 missense probably benign 0.03
R5320:Sim2 UTSW 16 94104739 missense probably benign 0.01
R5555:Sim2 UTSW 16 94109456 missense probably damaging 1.00
R5591:Sim2 UTSW 16 94097189 missense probably damaging 1.00
R5870:Sim2 UTSW 16 94123334 missense probably damaging 0.99
R6020:Sim2 UTSW 16 94097251 missense probably damaging 1.00
R6302:Sim2 UTSW 16 94097230 missense probably damaging 1.00
R6883:Sim2 UTSW 16 94125536 missense probably benign 0.00
R7170:Sim2 UTSW 16 94122700 missense probably benign 0.00
R7559:Sim2 UTSW 16 94109359 missense possibly damaging 0.95
R7740:Sim2 UTSW 16 94114960 missense probably benign 0.25
R8114:Sim2 UTSW 16 94122644 missense probably benign 0.00
R8244:Sim2 UTSW 16 94109363 missense probably damaging 0.99
R8682:Sim2 UTSW 16 94123333 missense probably benign 0.23
T0722:Sim2 UTSW 16 94109422 missense probably benign 0.02
X0063:Sim2 UTSW 16 94122698 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGCAGAAGACGTTGGGTGC -3'
(R):5'- GATTGGATTGTCCCTCAGCC -3'

Sequencing Primer
(F):5'- ACTCACCTGACCCCTGG -3'
(R):5'- CTTAGCTTAGGCCTGGGC -3'
Posted On 2014-08-25