Mutagenetix > Incidental Mutation

Incidental Mutation 'R2034:Sim2'

224385

Institutional Source

Beutler Lab

Gene Symbol

Sim2

Ensembl Gene

ENSMUSG00000062713

Gene Name

single-minded family bHLH transcription factor 2

Synonyms

bHLHe15

MMRRC Submission

040041-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2034 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

94084931-94127032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 94085942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 43 (I43L)

Ref Sequence

ENSEMBL: ENSMUSP00000072043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072182] [ENSMUST00000231688]

AlphaFold

Q61079

Predicted Effect

probably damaging
Transcript: ENSMUST00000072182
AA Change: I43L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072043
Gene: ENSMUSG00000062713
AA Change: I43L

Domain	Start	End	E-Value	Type
HLH	6	58	6.99e-5	SMART
PAS	79	145	7.8e-13	SMART
PAS	220	286	1.31e-5	SMART
PAC	292	335	2.44e-5	SMART
Pfam:SIM_C	358	650	4.5e-89	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231688
AA Change: I43L

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231710

Meta Mutation Damage Score

0.4538

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a homolog of the Drosophila single-minded (sim) gene, which encodes a transcription factor that is a master regulator of neurogenesis. The encoded protein is ubiquitinated by RING-IBR-RING-type E3 ubiquitin ligases, including the parkin RBR E3 ubiquitin protein ligase. This gene maps within the so-called Down syndrome chromosomal region, and is thus thought to contribute to some specific Down syndrome phenotypes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, cleft palate, malformed pterygoid processes, and aerophagia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,900,559	I65V	probably benign	Het
Abca13	A	G	11: 9,292,628	N1497S	possibly damaging	Het
Afmid	C	A	11: 117,835,235	N184K	probably benign	Het
Ampd2	A	T	3: 108,077,363	I459N	possibly damaging	Het
Anapc1	T	C	2: 128,648,458	D1018G	possibly damaging	Het
Ano9	T	A	7: 141,108,135	I223F	probably damaging	Het
B3gnt6	A	G	7: 98,194,018	L245P	possibly damaging	Het
Bag6	G	A	17: 35,144,692	R784Q	probably damaging	Het
Brca1	C	G	11: 101,489,849	S1786T	probably benign	Het
Btbd3	T	G	2: 138,278,983	S26A	probably benign	Het
Cacna1d	C	A	14: 30,089,863	V1277L	probably damaging	Het
Casp12	C	T	9: 5,346,491	T6I	probably damaging	Het
Col7a1	T	C	9: 108,963,007	V1262A	unknown	Het
Crh	C	A	3: 19,694,098	G127C	probably damaging	Het
D5Ertd579e	A	T	5: 36,613,538	L64*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddc	T	A	11: 11,880,456	I63L	probably benign	Het
Eif3a	C	T	19: 60,762,130		probably benign	Het
Fsip2	T	A	2: 82,989,494	N5190K	probably benign	Het
Gm5420	A	G	10: 21,691,613		noncoding transcript	Het
Grb14	A	G	2: 64,923,529		probably benign	Het
Gsap	A	T	5: 21,270,595	I545F	probably damaging	Het
Hectd1	A	T	12: 51,757,116		probably null	Het
Helz2	G	A	2: 181,232,578	P2041L	probably damaging	Het
Herc1	G	A	9: 66,441,972	A2038T	probably benign	Het
Il10	C	A	1: 131,024,185	Q152K	probably benign	Het
Klrg1	A	G	6: 122,279,637		probably null	Het
Lrig2	T	C	3: 104,494,092	T160A	probably benign	Het
Mmd2	A	T	5: 142,575,184		probably null	Het
Mmp2	C	T	8: 92,836,912	S338F	probably damaging	Het
Nalcn	T	G	14: 123,283,603	D1630A	probably benign	Het
Ncoa2	T	C	1: 13,164,983	S909G	probably benign	Het
Neb	A	T	2: 52,280,611	M1683K	possibly damaging	Het
Nfe2l3	A	G	6: 51,458,370	I637V	possibly damaging	Het
Npw	G	A	17: 24,658,268	S53F	probably damaging	Het
Nrbf2	A	T	10: 67,275,564		probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Nup188	T	A	2: 30,310,085		probably benign	Het
Olfr1444	T	A	19: 12,861,787	M4K	possibly damaging	Het
Olfr726	T	C	14: 50,083,983	M233V	probably benign	Het
Parp4	A	T	14: 56,634,263	I1133F	probably damaging	Het
Pcdhb11	T	C	18: 37,422,493	V292A	probably benign	Het
Pcnx2	A	G	8: 125,818,667		probably null	Het
Phf2	A	G	13: 48,817,730	S489P	unknown	Het
Pik3r5	T	A	11: 68,493,577	N598K	probably damaging	Het
Pikfyve	A	T	1: 65,222,357	E432D	probably damaging	Het
Pink1	T	C	4: 138,318,032	I274V	possibly damaging	Het
Pkhd1	G	A	1: 20,200,669	T3220I	probably damaging	Het
Plxna2	A	G	1: 194,780,594	I890V	probably benign	Het
Pomgnt1	T	C	4: 116,157,927	V492A	possibly damaging	Het
Prp2	G	T	6: 132,595,984		probably null	Het
Rabl6	T	C	2: 25,585,432	E543G	possibly damaging	Het
Rgp1	T	A	4: 43,581,605		probably null	Het
Rps6kb2	T	C	19: 4,161,107	T140A	probably damaging	Het
S100a11	T	C	3: 93,526,122	I91T	probably benign	Het
Serpine2	A	G	1: 79,796,852	L230P	probably damaging	Het
Sh3tc2	A	G	18: 61,987,666	D370G	probably damaging	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc14a2	A	G	18: 78,183,583	L419P	probably damaging	Het
Srgap1	C	T	10: 121,792,746	E817K	probably damaging	Het
Stag3	A	G	5: 138,298,001	E442G	possibly damaging	Het
Sulf1	A	G	1: 12,820,421	N361S	probably damaging	Het
Tmco6	A	G	18: 36,737,856		probably null	Het
Tmem104	T	A	11: 115,243,547	I303N	probably benign	Het
Ttll6	G	T	11: 96,135,526	D86Y	probably damaging	Het
Vmn1r120	T	G	7: 21,052,958	E276A	possibly damaging	Het
Vmn1r64	A	G	7: 5,883,989	M185T	probably benign	Het
Vmn2r85	A	T	10: 130,426,373		probably benign	Het
Vwa3a	A	T	7: 120,782,645	K568*	probably null	Het
Zcchc11	C	T	4: 108,512,195	R651W	probably damaging	Het

Other mutations in Sim2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sim2	APN	16	94114944	nonsense	probably null
IGL01329:Sim2	APN	16	94106260	missense	possibly damaging	0.64
IGL01965:Sim2	APN	16	94121178	missense	probably benign	0.20
IGL01979:Sim2	APN	16	94123482	missense	possibly damaging	0.81
IGL02821:Sim2	APN	16	94097188	missense	probably damaging	1.00
IGL03027:Sim2	APN	16	94109492	splice site	probably benign
P0027:Sim2	UTSW	16	94109422	missense	probably benign	0.02
PIT4696001:Sim2	UTSW	16	94094309	missense	possibly damaging	0.49
R1836:Sim2	UTSW	16	94123577	critical splice donor site	probably null
R4085:Sim2	UTSW	16	94109354	missense	possibly damaging	0.48
R4475:Sim2	UTSW	16	94125791	missense	probably benign
R4476:Sim2	UTSW	16	94125791	missense	probably benign
R4647:Sim2	UTSW	16	94123526	missense	possibly damaging	0.71
R4919:Sim2	UTSW	16	94109335	missense	probably benign	0.01
R4966:Sim2	UTSW	16	94123421	missense	probably benign	0.03
R5320:Sim2	UTSW	16	94104739	missense	probably benign	0.01
R5555:Sim2	UTSW	16	94109456	missense	probably damaging	1.00
R5591:Sim2	UTSW	16	94097189	missense	probably damaging	1.00
R5870:Sim2	UTSW	16	94123334	missense	probably damaging	0.99
R6020:Sim2	UTSW	16	94097251	missense	probably damaging	1.00
R6302:Sim2	UTSW	16	94097230	missense	probably damaging	1.00
R6883:Sim2	UTSW	16	94125536	missense	probably benign	0.00
R7170:Sim2	UTSW	16	94122700	missense	probably benign	0.00
R7559:Sim2	UTSW	16	94109359	missense	possibly damaging	0.95
R7740:Sim2	UTSW	16	94114960	missense	probably benign	0.25
R8114:Sim2	UTSW	16	94122644	missense	probably benign	0.00
R8244:Sim2	UTSW	16	94109363	missense	probably damaging	0.99
R8682:Sim2	UTSW	16	94123333	missense	probably benign	0.23
T0722:Sim2	UTSW	16	94109422	missense	probably benign	0.02
X0063:Sim2	UTSW	16	94122698	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTGCAGAAGACGTTGGGTGC -3'
(R):5'- GATTGGATTGTCCCTCAGCC -3'

Sequencing Primer
(F):5'- ACTCACCTGACCCCTGG -3'
(R):5'- CTTAGCTTAGGCCTGGGC -3'

Posted On

2014-08-25