Incidental Mutation 'R1997:Sec23a'
ID224394
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
MMRRC Submission 040007-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R1997 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59002007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 110 (I110L)
Ref Sequence ENSEMBL: ENSMUSP00000126011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect probably benign
Transcript: ENSMUST00000021375
AA Change: I139L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: I139L

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134223
Predicted Effect probably benign
Transcript: ENSMUST00000165134
AA Change: I110L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: I110L

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Camsap2 T C 1: 136,271,545 K708E probably damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dhcr7 T G 7: 143,847,430 D446E probably damaging Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Fkbp10 T C 11: 100,416,015 F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kcnh1 G A 1: 192,276,935 V266I probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
R7923:Sec23a UTSW 12 58992247 missense probably damaging 0.99
R8178:Sec23a UTSW 12 59007194 missense possibly damaging 0.93
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCAGTTGTTTGGCAGACAG -3'
(R):5'- TCTCTCCAGGACCACACATG -3'

Sequencing Primer
(F):5'- AGACAGATCCTTTGTTCCTCTGAAG -3'
(R):5'- ACACATGGCATGTTTCATTTCTG -3'
Posted On2014-08-25