Mutagenetix > Incidental Mutations

Incidental Mutation 'R1997:Traf3'

224396

Institutional Source

Beutler Lab

Gene Symbol

Traf3

Ensembl Gene

ENSMUSG00000021277

Gene Name

TNF receptor-associated factor 3

Synonyms

LAP1, CRAF1, CD40bp, CAP-1

MMRRC Submission

040007-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111166370-111267153 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111260661 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 328 (K328E)

Ref Sequence

ENSEMBL: ENSMUSP00000021706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]

PDB Structure

Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000021706
AA Change: K328E

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: K328E

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART
Pfam:zf-TRAF	135	191	4.6e-18	PFAM
Pfam:zf-TRAF	191	250	9.9e-14	PFAM
coiled coil region	298	337	N/A	INTRINSIC
MATH	419	542	5.69e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000060274
AA Change: K303E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: K303E

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART
Pfam:zf-TRAF	135	191	1.5e-17	PFAM
coiled coil region	273	312	N/A	INTRINSIC
MATH	394	517	5.69e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117269
AA Change: K303E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: K303E

Domain	Start	End	E-Value	Type
RING	52	87	5.85e-2	SMART
Pfam:zf-TRAF	135	191	1.5e-17	PFAM
coiled coil region	273	312	N/A	INTRINSIC
MATH	394	517	5.69e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143395

Meta Mutation Damage Score

0.0650

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Traf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Traf3	APN	12	111239067	missense	probably damaging	0.99
IGL02015:Traf3	APN	12	111252740	missense	probably benign
IGL02318:Traf3	APN	12	111237597	missense	probably benign
IGL02429:Traf3	APN	12	111243465	missense	probably benign	0.19
IGL03088:Traf3	APN	12	111261843	missense	probably damaging	0.99
bananasplit	UTSW	12	111262036	missense	probably damaging	1.00
Han	UTSW	12	111261576	missense	probably damaging	1.00
Hulk	UTSW	12	111261576	missense	probably damaging	1.00
Magnificent	UTSW	12	111237753	missense	probably damaging	1.00
sundae	UTSW	12	111255224	missense	possibly damaging	0.80
R0023:Traf3	UTSW	12	111243478	nonsense	probably null
R0143:Traf3	UTSW	12	111261576	missense	probably damaging	1.00
R1453:Traf3	UTSW	12	111255323	missense	probably damaging	0.96
R1507:Traf3	UTSW	12	111260760	missense	probably benign	0.30
R1651:Traf3	UTSW	12	111262036	missense	probably damaging	1.00
R1714:Traf3	UTSW	12	111242473	missense	probably benign	0.01
R1996:Traf3	UTSW	12	111260661	missense	probably benign	0.21
R3946:Traf3	UTSW	12	111255245	missense	possibly damaging	0.91
R4477:Traf3	UTSW	12	111248602	missense	probably benign	0.00
R4645:Traf3	UTSW	12	111261966	missense	probably damaging	1.00
R4723:Traf3	UTSW	12	111262036	missense	probably damaging	1.00
R4820:Traf3	UTSW	12	111260770	missense	possibly damaging	0.96
R5123:Traf3	UTSW	12	111243518	missense	possibly damaging	0.52
R5775:Traf3	UTSW	12	111252728	missense	possibly damaging	0.91
R5825:Traf3	UTSW	12	111255361	missense	probably benign	0.03
R5912:Traf3	UTSW	12	111255349	missense	probably benign	0.01
R6611:Traf3	UTSW	12	111237640	missense	possibly damaging	0.76
R6933:Traf3	UTSW	12	111255224	missense	possibly damaging	0.80
R7389:Traf3	UTSW	12	111237753	missense	probably damaging	1.00
R7425:Traf3	UTSW	12	111260661	nonsense	probably null
R8512:Traf3	UTSW	12	111261992	missense	probably benign	0.06
R8705:Traf3	UTSW	12	111242504	missense	possibly damaging	0.68
R8744:Traf3	UTSW	12	111261796	missense	probably benign	0.40
X0052:Traf3	UTSW	12	111252736	missense	probably benign	0.41
Z1176:Traf3	UTSW	12	111261836	missense	probably damaging	1.00
Z1177:Traf3	UTSW	12	111261492	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTCCTATCCCCAGAGACTCC -3'
(R):5'- GTGAAAACTGCCCCTACTAGAGG -3'

Sequencing Primer
(F):5'- TATCCCCAGAGACTCCCAGGAG -3'
(R):5'- TACTAGAGGCCTCCCAGCATG -3'

Posted On

2014-08-25