Incidental Mutation 'R2034:Eif3a'
ID 224405
Institutional Source Beutler Lab
Gene Symbol Eif3a
Ensembl Gene ENSMUSG00000024991
Gene Name eukaryotic translation initiation factor 3, subunit A
Synonyms Eif3s10, A830012B05Rik, Eif3, Csma
MMRRC Submission 040041-MU
Accession Numbers

Genbank: NM_010123

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R2034 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 60761116-60790693 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 60762130 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025955] [ENSMUST00000088237]
AlphaFold P23116
Predicted Effect unknown
Transcript: ENSMUST00000025955
AA Change: R1329H
SMART Domains Protein: ENSMUSP00000025955
Gene: ENSMUSG00000024991
AA Change: R1329H

DomainStartEndE-ValueType
coiled coil region 82 120 N/A INTRINSIC
PINT 426 506 5.69e-18 SMART
SCOP:d1f5aa2 563 711 5e-3 SMART
coiled coil region 772 880 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
low complexity region 951 976 N/A INTRINSIC
internal_repeat_2 978 991 1.01e-8 PROSPERO
low complexity region 993 1007 N/A INTRINSIC
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1033 1057 N/A INTRINSIC
low complexity region 1064 1089 N/A INTRINSIC
internal_repeat_1 1090 1111 6.2e-12 PROSPERO
internal_repeat_2 1099 1112 1.01e-8 PROSPERO
internal_repeat_1 1110 1131 6.2e-12 PROSPERO
low complexity region 1146 1173 N/A INTRINSIC
low complexity region 1176 1206 N/A INTRINSIC
low complexity region 1221 1260 N/A INTRINSIC
low complexity region 1265 1297 N/A INTRINSIC
low complexity region 1301 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088237
SMART Domains Protein: ENSMUSP00000096874
Gene: ENSMUSG00000072437

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
low complexity region 65 110 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
Pfam:zf-nanos 189 242 1e-28 PFAM
low complexity region 245 255 N/A INTRINSIC
Meta Mutation Damage Score 0.1181 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
Allele List at MGI

All alleles(36) : Targeted, other(2) Gene trapped(34)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Hectd1 A T 12: 51,757,116 probably null Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Eif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Eif3a APN 19 60769890 missense unknown
IGL00981:Eif3a APN 19 60766611 missense unknown
IGL01650:Eif3a APN 19 60773996 missense probably damaging 1.00
IGL01926:Eif3a APN 19 60769961 missense unknown
IGL02100:Eif3a APN 19 60767004 splice site probably benign
IGL02316:Eif3a APN 19 60771638 splice site probably benign
IGL02444:Eif3a APN 19 60773607 missense possibly damaging 0.89
IGL02552:Eif3a APN 19 60763226 unclassified probably benign
IGL02797:Eif3a APN 19 60772726 missense probably damaging 1.00
IGL03108:Eif3a APN 19 60782309 missense possibly damaging 0.85
FR4304:Eif3a UTSW 19 60775290 critical splice donor site probably benign
FR4548:Eif3a UTSW 19 60775291 critical splice donor site probably benign
FR4737:Eif3a UTSW 19 60775289 critical splice donor site probably benign
FR4976:Eif3a UTSW 19 60775291 critical splice donor site probably benign
G5538:Eif3a UTSW 19 60781902 missense probably damaging 0.97
R0054:Eif3a UTSW 19 60766826 missense unknown
R0054:Eif3a UTSW 19 60766826 missense unknown
R1483:Eif3a UTSW 19 60768726 missense unknown
R1636:Eif3a UTSW 19 60781905 missense possibly damaging 0.93
R1748:Eif3a UTSW 19 60766798 missense unknown
R1857:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1858:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1993:Eif3a UTSW 19 60781516 missense probably benign 0.19
R2099:Eif3a UTSW 19 60764113 unclassified probably benign
R2140:Eif3a UTSW 19 60775394 splice site probably benign
R2434:Eif3a UTSW 19 60764050 unclassified probably benign
R2940:Eif3a UTSW 19 60773677 missense probably benign 0.22
R4630:Eif3a UTSW 19 60769928 missense unknown
R4630:Eif3a UTSW 19 60777986 missense probably benign 0.41
R4926:Eif3a UTSW 19 60763218 unclassified probably benign
R5366:Eif3a UTSW 19 60779533 missense probably benign 0.12
R6003:Eif3a UTSW 19 60766881 missense unknown
R6082:Eif3a UTSW 19 60772130 missense possibly damaging 0.82
R6256:Eif3a UTSW 19 60771026 missense possibly damaging 0.72
R7056:Eif3a UTSW 19 60763062 splice site probably null
R7365:Eif3a UTSW 19 60766644 missense unknown
R7922:Eif3a UTSW 19 60775842 missense probably damaging 1.00
R8076:Eif3a UTSW 19 60773925 missense probably damaging 0.97
R8169:Eif3a UTSW 19 60762190 missense unknown
R8246:Eif3a UTSW 19 60779368 missense probably damaging 1.00
R8474:Eif3a UTSW 19 60779491 missense possibly damaging 0.63
R8546:Eif3a UTSW 19 60766770 missense unknown
R8964:Eif3a UTSW 19 60763192 missense unknown
R9071:Eif3a UTSW 19 60763196 missense unknown
R9290:Eif3a UTSW 19 60776783 missense probably damaging 1.00
X0028:Eif3a UTSW 19 60781902 missense probably damaging 0.97
X0066:Eif3a UTSW 19 60762293 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAAAATGGCATGGTTTTCC -3'
(R):5'- TAGCAAGCTCTTGGAGACGC -3'

Sequencing Primer
(F):5'- TGTGAATACAGTGCATGATCAATC -3'
(R):5'- TCTTGGAGACGCACTGATGAC -3'
Posted On 2014-08-25