Incidental Mutation 'R0143:Fes'
ID22441
Institutional Source Beutler Lab
Gene Symbol Fes
Ensembl Gene ENSMUSG00000053158
Gene Namefeline sarcoma oncogene
Synonymsc-fes
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location80377756-80387946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80383895 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 203 (F203V)
Ref Sequence ENSEMBL: ENSMUSP00000145612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206735] [ENSMUST00000206744]
Predicted Effect probably benign
Transcript: ENSMUST00000080932
AA Change: F203V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: F203V

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect probably benign
Transcript: ENSMUST00000205617
AA Change: F203V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206271
Predicted Effect probably benign
Transcript: ENSMUST00000206479
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably benign
Transcript: ENSMUST00000206698
Predicted Effect probably benign
Transcript: ENSMUST00000206728
AA Change: F203V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206735
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Fes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Fes APN 7 80383273 missense probably benign 0.01
IGL01654:Fes APN 7 80386810 critical splice donor site probably null
IGL02350:Fes APN 7 80383830 splice site probably null
IGL02357:Fes APN 7 80383830 splice site probably null
IGL02811:Fes APN 7 80379841 missense probably damaging 1.00
BB009:Fes UTSW 7 80379872 missense probably damaging 0.99
BB019:Fes UTSW 7 80379872 missense probably damaging 0.99
R0112:Fes UTSW 7 80384005 missense probably damaging 0.99
R0114:Fes UTSW 7 80378035 missense probably damaging 0.99
R0786:Fes UTSW 7 80386920 missense probably damaging 1.00
R0863:Fes UTSW 7 80380886 missense probably damaging 1.00
R0918:Fes UTSW 7 80381205 missense probably damaging 1.00
R1167:Fes UTSW 7 80383109 missense probably damaging 1.00
R1174:Fes UTSW 7 80377951 missense probably damaging 1.00
R1674:Fes UTSW 7 80377938 missense probably benign 0.04
R1898:Fes UTSW 7 80379911 missense probably damaging 1.00
R1908:Fes UTSW 7 80386861 missense probably damaging 0.98
R1909:Fes UTSW 7 80386861 missense probably damaging 0.98
R1922:Fes UTSW 7 80383986 nonsense probably null
R2209:Fes UTSW 7 80380283 missense probably damaging 1.00
R2242:Fes UTSW 7 80381725 missense probably damaging 1.00
R3012:Fes UTSW 7 80387167 missense possibly damaging 0.81
R4607:Fes UTSW 7 80387211 missense probably damaging 1.00
R4608:Fes UTSW 7 80387211 missense probably damaging 1.00
R4982:Fes UTSW 7 80387204 missense probably damaging 1.00
R5516:Fes UTSW 7 80387183 missense probably damaging 1.00
R6120:Fes UTSW 7 80380867 missense probably damaging 1.00
R6148:Fes UTSW 7 80380296 missense probably damaging 1.00
R7161:Fes UTSW 7 80380861 missense probably damaging 0.98
R7401:Fes UTSW 7 80378776 critical splice donor site probably null
R7408:Fes UTSW 7 80378662 missense probably damaging 1.00
R7761:Fes UTSW 7 80380867 missense probably damaging 1.00
R7932:Fes UTSW 7 80379872 missense probably damaging 0.99
R8261:Fes UTSW 7 80383154 missense probably null 1.00
Z1177:Fes UTSW 7 80378030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTGTCTCCCCAAGGCTTAG -3'
(R):5'- GCCAGCAAAGGTTCGCTCTTCTTC -3'

Sequencing Primer
(F):5'- AGGCTTAGCACCGCCAC -3'
(R):5'- GTCTAGTAGACCTATAGCTAGTGCC -3'
Posted On2013-04-16