Incidental Mutation 'R2035:Unc80'
ID224412
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66606593 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1476 (D1476V)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect probably damaging
Transcript: ENSMUST00000061620
AA Change: D1476V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: D1476V

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212557
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 intron probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 intron probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
R7855:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66510707 missense probably benign 0.00
R7938:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7961:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7962:Unc80 UTSW 1 66510707 missense probably benign 0.00
R8024:Unc80 UTSW 1 66606644 missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66483304 missense possibly damaging 0.92
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66694409 missense probably benign
Z1177:Unc80 UTSW 1 66646398 missense possibly damaging 0.72
Z1177:Unc80 UTSW 1 66695339 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGTGGATCTAAACTGGCTG -3'
(R):5'- AGTGCGTTGTCTTAACTATGGC -3'

Sequencing Primer
(F):5'- TCTAAACTGGCTGGGGAAAAAC -3'
(R):5'- GCGTTGTCTTAACTATGGCTCTGC -3'
Posted On2014-08-25