Incidental Mutation 'R1997:Acin1'
ID 224426
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Name apoptotic chromatin condensation inducer 1
Synonyms 2610036I19Rik, 2610510L13Rik, Acinus
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R1997 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 54879618-54924388 bp(-) (GRCm39)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 54884156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000022793] [ENSMUST00000022794] [ENSMUST00000022794] [ENSMUST00000022794] [ENSMUST00000022794] [ENSMUST00000111484] [ENSMUST00000111484] [ENSMUST00000111484] [ENSMUST00000111484] [ENSMUST00000123875] [ENSMUST00000123875] [ENSMUST00000123875] [ENSMUST00000123875] [ENSMUST00000126166] [ENSMUST00000126166] [ENSMUST00000141453] [ENSMUST00000141453] [ENSMUST00000148754] [ENSMUST00000148754] [ENSMUST00000148754] [ENSMUST00000148754] [ENSMUST00000150371] [ENSMUST00000150371] [ENSMUST00000167015] [ENSMUST00000167015] [ENSMUST00000169818]
AlphaFold Q9JIX8
Predicted Effect probably null
Transcript: ENSMUST00000022793
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022793
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125767
Predicted Effect probably null
Transcript: ENSMUST00000126166
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126166
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133706
Predicted Effect probably null
Transcript: ENSMUST00000141453
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141453
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147714
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147714
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150371
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150371
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167015
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167015
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137763
Predicted Effect probably benign
Transcript: ENSMUST00000169818
SMART Domains Protein: ENSMUSP00000131860
Gene: ENSMUSG00000091306

DomainStartEndE-ValueType
low complexity region 1 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138321
SMART Domains Protein: ENSMUSP00000119326
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Pfam:RSB_motif 20 128 4.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54,884,257 (GRCm39) missense probably damaging 1.00
IGL01530:Acin1 APN 14 54,881,443 (GRCm39) missense probably damaging 1.00
IGL02396:Acin1 APN 14 54,882,256 (GRCm39) intron probably benign
IGL02967:Acin1 APN 14 54,880,210 (GRCm39) missense possibly damaging 0.80
Protuberant UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R0411:Acin1 UTSW 14 54,884,231 (GRCm39) missense probably damaging 1.00
R0723:Acin1 UTSW 14 54,902,908 (GRCm39) missense probably damaging 0.98
R0755:Acin1 UTSW 14 54,889,292 (GRCm39) start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54,890,985 (GRCm39) unclassified probably benign
R1600:Acin1 UTSW 14 54,881,174 (GRCm39) intron probably benign
R1682:Acin1 UTSW 14 54,901,175 (GRCm39) missense probably damaging 1.00
R1721:Acin1 UTSW 14 54,901,995 (GRCm39) missense probably benign 0.01
R1756:Acin1 UTSW 14 54,902,661 (GRCm39) missense probably benign 0.30
R1867:Acin1 UTSW 14 54,881,718 (GRCm39) missense probably damaging 1.00
R2067:Acin1 UTSW 14 54,902,711 (GRCm39) missense probably damaging 1.00
R3947:Acin1 UTSW 14 54,916,790 (GRCm39) missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54,891,351 (GRCm39) unclassified probably benign
R4476:Acin1 UTSW 14 54,882,787 (GRCm39) missense probably damaging 1.00
R4501:Acin1 UTSW 14 54,924,044 (GRCm39) missense probably damaging 1.00
R4547:Acin1 UTSW 14 54,883,124 (GRCm39) missense probably benign 0.01
R4621:Acin1 UTSW 14 54,890,900 (GRCm39) unclassified probably benign
R4657:Acin1 UTSW 14 54,880,504 (GRCm39) missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54,924,215 (GRCm39) missense probably benign 0.00
R4696:Acin1 UTSW 14 54,880,474 (GRCm39) intron probably benign
R4806:Acin1 UTSW 14 54,916,685 (GRCm39) splice site probably benign
R4826:Acin1 UTSW 14 54,902,074 (GRCm39) missense probably damaging 0.97
R5096:Acin1 UTSW 14 54,916,679 (GRCm39) intron probably benign
R5153:Acin1 UTSW 14 54,883,070 (GRCm39) missense probably benign 0.25
R5223:Acin1 UTSW 14 54,880,398 (GRCm39) frame shift probably null
R5260:Acin1 UTSW 14 54,880,279 (GRCm39) intron probably benign
R5525:Acin1 UTSW 14 54,901,848 (GRCm39) missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54,916,195 (GRCm39) splice site probably null
R5902:Acin1 UTSW 14 54,901,130 (GRCm39) missense probably benign 0.01
R6211:Acin1 UTSW 14 54,881,503 (GRCm39) missense probably damaging 1.00
R6524:Acin1 UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R6560:Acin1 UTSW 14 54,916,290 (GRCm39) missense probably benign 0.24
R6916:Acin1 UTSW 14 54,902,873 (GRCm39) missense probably benign 0.27
R7201:Acin1 UTSW 14 54,902,356 (GRCm39) missense possibly damaging 0.83
R7833:Acin1 UTSW 14 54,902,059 (GRCm39) missense possibly damaging 0.83
R8096:Acin1 UTSW 14 54,882,726 (GRCm39) missense possibly damaging 0.80
R8167:Acin1 UTSW 14 54,902,337 (GRCm39) missense probably benign 0.01
R8421:Acin1 UTSW 14 54,880,486 (GRCm39) missense unknown
R8771:Acin1 UTSW 14 54,880,496 (GRCm39) missense unknown
R8862:Acin1 UTSW 14 54,901,172 (GRCm39) missense probably benign 0.00
R9645:Acin1 UTSW 14 54,901,913 (GRCm39) missense probably benign 0.16
R9755:Acin1 UTSW 14 54,889,292 (GRCm39) missense probably damaging 0.99
X0021:Acin1 UTSW 14 54,904,558 (GRCm39) missense probably damaging 1.00
Z1177:Acin1 UTSW 14 54,880,207 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATCGTCGCCATTACGCTCTG -3'
(R):5'- GGTGTGAGCTAGTTAGGAACC -3'

Sequencing Primer
(F):5'- TCTCATCCTCAGAGATTCGGGAG -3'
(R):5'- GGAACCTAGACCATCTAACTGTTGG -3'
Posted On 2014-08-25