Incidental Mutation 'R1997:Ap1g2'
ID 224428
Institutional Source Beutler Lab
Gene Symbol Ap1g2
Ensembl Gene ENSMUSG00000040701
Gene Name adaptor protein complex AP-1, gamma 2 subunit
Synonyms gamma 2-adaptin, Adtg2
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R1997 (G1)
Quality Score 178
Status Not validated
Chromosome 14
Chromosomal Location 55336292-55344050 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55339835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 448 (E448G)
Ref Sequence ENSEMBL: ENSMUSP00000128427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022819] [ENSMUST00000036041] [ENSMUST00000050575] [ENSMUST00000124493] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000170285] [ENSMUST00000151314] [ENSMUST00000183822] [ENSMUST00000185121]
AlphaFold O88512
Predicted Effect probably benign
Transcript: ENSMUST00000022819
SMART Domains Protein: ENSMUSP00000022819
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036041
AA Change: E448G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701
AA Change: E448G

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050575
SMART Domains Protein: ENSMUSP00000056026
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
CYTH 5 200 1.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124493
SMART Domains Protein: ENSMUSP00000121893
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170285
AA Change: E448G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701
AA Change: E448G

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139536
Predicted Effect probably benign
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Polg A G 7: 79,108,979 (GRCm39) L533P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Ap1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1g2 APN 14 55,342,571 (GRCm39) missense probably benign 0.01
IGL02421:Ap1g2 APN 14 55,339,859 (GRCm39) missense probably damaging 1.00
IGL02633:Ap1g2 APN 14 55,338,104 (GRCm39) splice site probably null
IGL02967:Ap1g2 APN 14 55,342,479 (GRCm39) splice site probably benign
IGL03030:Ap1g2 APN 14 55,343,504 (GRCm39) missense probably damaging 1.00
IGL03087:Ap1g2 APN 14 55,340,493 (GRCm39) missense probably damaging 0.99
IGL03261:Ap1g2 APN 14 55,337,987 (GRCm39) missense probably benign 0.00
IGL03308:Ap1g2 APN 14 55,342,333 (GRCm39) missense probably benign 0.44
R0284:Ap1g2 UTSW 14 55,339,149 (GRCm39) splice site probably benign
R0614:Ap1g2 UTSW 14 55,337,230 (GRCm39) missense probably benign 0.00
R0762:Ap1g2 UTSW 14 55,337,868 (GRCm39) splice site probably benign
R1561:Ap1g2 UTSW 14 55,342,344 (GRCm39) missense probably damaging 1.00
R1889:Ap1g2 UTSW 14 55,338,886 (GRCm39) missense probably damaging 1.00
R1938:Ap1g2 UTSW 14 55,337,229 (GRCm39) missense possibly damaging 0.80
R2169:Ap1g2 UTSW 14 55,336,797 (GRCm39) critical splice acceptor site probably null
R3157:Ap1g2 UTSW 14 55,336,731 (GRCm39) missense probably damaging 0.96
R3820:Ap1g2 UTSW 14 55,338,030 (GRCm39) splice site probably benign
R3850:Ap1g2 UTSW 14 55,342,363 (GRCm39) missense probably benign 0.03
R4750:Ap1g2 UTSW 14 55,341,822 (GRCm39) missense probably damaging 1.00
R4909:Ap1g2 UTSW 14 55,342,483 (GRCm39) critical splice donor site probably null
R5305:Ap1g2 UTSW 14 55,336,533 (GRCm39) missense probably benign
R5880:Ap1g2 UTSW 14 55,340,157 (GRCm39) missense probably damaging 1.00
R6243:Ap1g2 UTSW 14 55,336,530 (GRCm39) missense probably benign
R6964:Ap1g2 UTSW 14 55,336,722 (GRCm39) missense possibly damaging 0.85
R7039:Ap1g2 UTSW 14 55,340,111 (GRCm39) nonsense probably null
R7180:Ap1g2 UTSW 14 55,341,908 (GRCm39) missense probably damaging 1.00
R7563:Ap1g2 UTSW 14 55,337,206 (GRCm39) missense probably damaging 1.00
R7818:Ap1g2 UTSW 14 55,337,181 (GRCm39) missense probably benign 0.44
R7854:Ap1g2 UTSW 14 55,343,390 (GRCm39) missense probably damaging 1.00
R9060:Ap1g2 UTSW 14 55,337,887 (GRCm39) missense probably benign 0.00
R9171:Ap1g2 UTSW 14 55,336,581 (GRCm39) missense probably benign 0.05
R9276:Ap1g2 UTSW 14 55,339,818 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCAGCCTGTAGTCACCAG -3'
(R):5'- CAGCACTGATGAGCCATGTC -3'

Sequencing Primer
(F):5'- TGTAGTCACCAGGGGCAG -3'
(R):5'- ACTGATGAGCCATGTCCCCTAG -3'
Posted On 2014-08-25