Incidental Mutation 'R0143:Cog7'
ID22443
Institutional Source Beutler Lab
Gene Symbol Cog7
Ensembl Gene ENSMUSG00000034951
Gene Namecomponent of oligomeric golgi complex 7
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location121879363-121981711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121951164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 379 (L379Q)
Ref Sequence ENSEMBL: ENSMUSP00000146193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057576] [ENSMUST00000205438]
Predicted Effect probably damaging
Transcript: ENSMUST00000057576
AA Change: L379Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058990
Gene: ENSMUSG00000034951
AA Change: L379Q

DomainStartEndE-ValueType
Pfam:COG7 2 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148634
Predicted Effect probably damaging
Transcript: ENSMUST00000205438
AA Change: L379Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1559 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Cog7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Cog7 APN 7 121943777 critical splice donor site probably null
IGL02094:Cog7 APN 7 121963247 missense probably benign 0.21
IGL02113:Cog7 APN 7 121925480 missense probably damaging 1.00
IGL02151:Cog7 APN 7 121943808 missense probably damaging 0.97
IGL02365:Cog7 APN 7 121977736 missense possibly damaging 0.56
IGL02398:Cog7 APN 7 121964209 missense probably damaging 1.00
IGL02732:Cog7 APN 7 121923367 missense probably benign 0.05
IGL02887:Cog7 APN 7 121943844 missense possibly damaging 0.83
R0446:Cog7 UTSW 7 121937072 missense probably benign
R0521:Cog7 UTSW 7 121941169 critical splice donor site probably null
R0526:Cog7 UTSW 7 121963271 splice site probably null
R0658:Cog7 UTSW 7 121956140 splice site probably benign
R0782:Cog7 UTSW 7 121943797 missense possibly damaging 0.86
R1029:Cog7 UTSW 7 121930529 critical splice donor site probably null
R1419:Cog7 UTSW 7 121955992 missense probably damaging 0.99
R1521:Cog7 UTSW 7 121930574 missense possibly damaging 0.57
R1639:Cog7 UTSW 7 121981419 missense probably damaging 1.00
R2023:Cog7 UTSW 7 121936970 missense probably damaging 0.99
R3896:Cog7 UTSW 7 121941169 critical splice donor site probably benign
R4240:Cog7 UTSW 7 121925484 missense possibly damaging 0.50
R4731:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4732:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4733:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4838:Cog7 UTSW 7 121971381 missense probably damaging 1.00
R5001:Cog7 UTSW 7 121949886 missense probably damaging 1.00
R5237:Cog7 UTSW 7 121951221 missense probably damaging 1.00
R5353:Cog7 UTSW 7 121941247 splice site probably null
R5609:Cog7 UTSW 7 121925460 missense probably benign 0.12
R5964:Cog7 UTSW 7 121956029 missense probably damaging 0.99
R6544:Cog7 UTSW 7 121935743 missense probably damaging 0.99
R6784:Cog7 UTSW 7 121964293 splice site probably null
R7110:Cog7 UTSW 7 121935776 missense probably damaging 0.98
R7212:Cog7 UTSW 7 121977314 missense probably damaging 0.98
R7304:Cog7 UTSW 7 121937139 missense probably benign 0.04
R8185:Cog7 UTSW 7 121977746 missense probably damaging 1.00
R8207:Cog7 UTSW 7 121977292 missense possibly damaging 0.70
X0066:Cog7 UTSW 7 121977624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACAGAGATGTCCTTGAGCAACC -3'
(R):5'- TGTGCCAGCAGAATACCTTTCCC -3'

Sequencing Primer
(F):5'- AAGCACACGGGTAGCTTC -3'
(R):5'- CAGCAGAATACCTTTCCCTATTG -3'
Posted On2013-04-16