Incidental Mutation 'R2035:Grin3a'
ID224444
Institutional Source Beutler Lab
Gene Symbol Grin3a
Ensembl Gene ENSMUSG00000039579
Gene Nameglutamate receptor ionotropic, NMDA3A
SynonymsNR3A, A830097C19Rik, NMDAR-L
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49661611-49845744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49771336 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 479 (T479A)
Ref Sequence ENSEMBL: ENSMUSP00000075970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect probably damaging
Transcript: ENSMUST00000076674
AA Change: T479A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579
AA Change: T479A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093859
AA Change: T479A

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: T479A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131797
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Grin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Grin3a APN 4 49770589 missense probably damaging 1.00
IGL01541:Grin3a APN 4 49792533 missense probably damaging 0.98
IGL01886:Grin3a APN 4 49702814 missense probably damaging 1.00
IGL02133:Grin3a APN 4 49792946 nonsense probably null
IGL02367:Grin3a APN 4 49702805 missense probably damaging 1.00
IGL02481:Grin3a APN 4 49702868 missense probably damaging 1.00
IGL02830:Grin3a APN 4 49702787 missense possibly damaging 0.94
IGL02945:Grin3a APN 4 49792971 missense possibly damaging 0.86
IGL03174:Grin3a APN 4 49771107 missense probably damaging 1.00
R0266:Grin3a UTSW 4 49665501 nonsense probably null
R0597:Grin3a UTSW 4 49665351 missense probably damaging 1.00
R0849:Grin3a UTSW 4 49665501 nonsense probably null
R1448:Grin3a UTSW 4 49702804 missense probably damaging 1.00
R1640:Grin3a UTSW 4 49844721 missense probably benign
R1751:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1767:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1858:Grin3a UTSW 4 49792437 missense probably benign 0.01
R1860:Grin3a UTSW 4 49665309 missense possibly damaging 0.95
R1924:Grin3a UTSW 4 49844988 missense possibly damaging 0.95
R2108:Grin3a UTSW 4 49665510 missense possibly damaging 0.91
R2307:Grin3a UTSW 4 49793033 critical splice acceptor site probably null
R3082:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3083:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3430:Grin3a UTSW 4 49792534 missense probably benign 0.01
R3695:Grin3a UTSW 4 49792704 missense possibly damaging 0.81
R3932:Grin3a UTSW 4 49672472 critical splice donor site probably null
R4559:Grin3a UTSW 4 49844555 missense probably damaging 1.00
R4972:Grin3a UTSW 4 49770484 missense probably damaging 1.00
R4982:Grin3a UTSW 4 49665512 missense probably benign 0.03
R5385:Grin3a UTSW 4 49719313 missense probably damaging 1.00
R5423:Grin3a UTSW 4 49770376 intron probably benign
R5478:Grin3a UTSW 4 49792481 missense probably benign 0.00
R5634:Grin3a UTSW 4 49792843 missense probably damaging 1.00
R5790:Grin3a UTSW 4 49792717 missense probably damaging 1.00
R5976:Grin3a UTSW 4 49792602 missense probably damaging 1.00
R6271:Grin3a UTSW 4 49792516 missense probably benign 0.00
R6451:Grin3a UTSW 4 49844969 missense probably damaging 1.00
R6538:Grin3a UTSW 4 49770856 missense probably damaging 1.00
R6629:Grin3a UTSW 4 49844991 missense probably damaging 1.00
R7217:Grin3a UTSW 4 49770741 missense possibly damaging 0.81
R7337:Grin3a UTSW 4 49702762 missense probably damaging 1.00
R7338:Grin3a UTSW 4 49771238 missense probably benign
R7477:Grin3a UTSW 4 49719278 missense probably damaging 1.00
Z1176:Grin3a UTSW 4 49770622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGTCATAGGGTCTAGACAGAGTTG -3'
(R):5'- TGGCTCTGGTACTTGACTTCAG -3'

Sequencing Primer
(F):5'- TGTCCAGCAGGGCATAAGC -3'
(R):5'- GGTACTTGACTTCAGAATTGCC -3'
Posted On2014-08-25