Incidental Mutation 'R1997:Aaas'
ID224446
Institutional Source Beutler Lab
Gene Symbol Aaas
Ensembl Gene ENSMUSG00000036678
Gene Nameachalasia, adrenocortical insufficiency, alacrimia
SynonymsD030041N15Rik, GL003, Aladin
MMRRC Submission 040007-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R1997 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102338252-102350771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102340059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 241 (V241I)
Ref Sequence ENSEMBL: ENSMUSP00000155757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682] [ENSMUST00000228959] [ENSMUST00000229900] [ENSMUST00000231061] [ENSMUST00000230481]
Predicted Effect probably benign
Transcript: ENSMUST00000001331
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
AA Change: V274I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678
AA Change: V274I

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113682
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect probably benign
Transcript: ENSMUST00000171244
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Predicted Effect probably benign
Transcript: ENSMUST00000228959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect probably benign
Transcript: ENSMUST00000231061
AA Change: V241I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230406
Predicted Effect probably benign
Transcript: ENSMUST00000230481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Predicted Effect probably benign
Transcript: ENSMUST00000230239
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice display female infertility, mildly decreased exploratory behavior, and decreased body weight, but have normal adrenocortical function and do not develop severe neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,932,429 Q536L probably damaging Het
3425401B19Rik A G 14: 32,660,048 F1320S possibly damaging Het
Abca17 A G 17: 24,285,726 I1233T probably benign Het
Acin1 T C 14: 54,646,699 probably null Het
Acly A T 11: 100,519,151 I185N probably damaging Het
Adamts16 T C 13: 70,753,267 D897G probably benign Het
Allc A C 12: 28,563,483 D153E probably benign Het
Ankrd12 A G 17: 65,984,884 S1185P probably damaging Het
Ap1g2 T C 14: 55,102,378 E448G probably benign Het
Atg9a A T 1: 75,189,626 V50D probably benign Het
Bace2 A T 16: 97,415,089 D294V possibly damaging Het
Camsap2 T C 1: 136,271,545 K708E probably damaging Het
Card10 G A 15: 78,793,975 R358C probably damaging Het
Ccdc81 A T 7: 89,898,063 V39E probably damaging Het
Cdh7 A T 1: 110,048,938 D111V probably damaging Het
Cercam C A 2: 29,872,923 T223K probably benign Het
Cog5 A G 12: 31,660,849 H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Csrnp3 A T 2: 65,949,102 N41Y probably damaging Het
Cyp2t4 G A 7: 27,157,613 probably null Het
Dbn1 T C 13: 55,482,441 H38R probably damaging Het
Dclre1b A G 3: 103,803,356 V287A probably benign Het
Dennd4c A G 4: 86,837,397 T1609A probably benign Het
Depdc5 T A 5: 32,901,906 probably null Het
Dhcr7 T G 7: 143,847,430 D446E probably damaging Het
Dlx5 A T 6: 6,879,680 M129K possibly damaging Het
Dnah11 C G 12: 118,082,468 G1745A possibly damaging Het
Dnm3 T C 1: 162,353,712 T133A possibly damaging Het
Eif3e A G 15: 43,265,609 L205P probably damaging Het
Fam166a T G 2: 25,220,205 L43R probably damaging Het
Fam91a1 A G 15: 58,424,195 probably null Het
Fank1 C T 7: 133,862,225 T50I probably damaging Het
Fhod3 A G 18: 25,090,416 T940A possibly damaging Het
Fkbp10 T C 11: 100,416,015 F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 F387C probably damaging Het
Ggnbp2 A T 11: 84,860,561 L138I probably damaging Het
Gm2832 T A 14: 41,280,986 probably null Het
Gm38394 A G 1: 133,656,713 L962P probably damaging Het
Gm5084 T A 13: 60,212,530 noncoding transcript Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Hepacam2 A G 6: 3,487,241 S39P probably damaging Het
Hesx1 A T 14: 27,001,383 N57Y probably damaging Het
Kcnh1 G A 1: 192,276,935 V266I probably damaging Het
Kif24 T C 4: 41,392,904 T1168A possibly damaging Het
Kng2 A T 16: 23,024,876 F118I possibly damaging Het
Lig3 C T 11: 82,787,666 P245S probably benign Het
Loxhd1 G T 18: 77,295,769 W121C probably damaging Het
Ltn1 A G 16: 87,381,637 V1568A probably damaging Het
Map3k4 A T 17: 12,254,995 probably null Het
Mcm10 C T 2: 4,993,760 V790M probably damaging Het
Mia3 A T 1: 183,344,286 F1223I possibly damaging Het
Mlec C A 5: 115,150,346 K150N probably damaging Het
Morn4 T C 19: 42,076,538 K70R possibly damaging Het
Mphosph10 A C 7: 64,387,447 probably null Het
Myocd G A 11: 65,204,321 Q47* probably null Het
Nav2 T A 7: 49,548,471 S1283T probably benign Het
Nbeal2 T C 9: 110,632,198 H1599R probably damaging Het
Nek10 G T 14: 14,827,003 G67V probably benign Het
Nlgn2 A C 11: 69,828,050 V271G probably damaging Het
Olfr167 A C 16: 19,515,042 V198G probably damaging Het
Olfr97 A G 17: 37,231,632 V246A probably damaging Het
Pcolce2 A T 9: 95,694,740 M355L probably benign Het
Per2 T C 1: 91,440,859 E264G probably damaging Het
Phf2 A G 13: 48,828,908 L113P unknown Het
Piwil2 A G 14: 70,426,658 V14A possibly damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pms2 T C 5: 143,913,700 L111P probably damaging Het
Polg A G 7: 79,459,231 L533P probably damaging Het
Ppp1r12b A G 1: 134,846,355 probably benign Het
Ppp2r1b T A 9: 50,867,371 M208K possibly damaging Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Prkar2b A G 12: 31,963,935 V314A probably damaging Het
Proser1 T A 3: 53,478,871 S725T probably benign Het
Psg20 A G 7: 18,682,610 F194L probably benign Het
Ptprz1 A G 6: 23,050,497 I2255V probably damaging Het
Sardh T G 2: 27,244,397 T36P probably damaging Het
Sec23a T A 12: 59,002,007 I110L probably benign Het
Slc22a29 T A 19: 8,217,798 I158L probably benign Het
Slc35c1 T C 2: 92,454,639 D210G probably benign Het
Syde2 A G 3: 145,998,991 N566S probably benign Het
Tcf20 G A 15: 82,857,230 Q7* probably null Het
Terb2 T A 2: 122,204,857 H186Q possibly damaging Het
Tet2 G A 3: 133,486,589 Q695* probably null Het
Tnfaip1 T C 11: 78,530,147 Y29C probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Uaca A G 9: 60,870,341 E668G probably damaging Het
Ube2o T A 11: 116,545,337 E326V probably damaging Het
Ubr1 C T 2: 120,946,273 probably null Het
Vmn1r19 T A 6: 57,405,048 S195R probably damaging Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r19 T A 6: 123,315,921 D307E probably damaging Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Zan A T 5: 137,403,114 C4114* probably null Het
Zdhhc23 A T 16: 43,978,942 C37S probably damaging Het
Zfp628 G T 7: 4,918,832 G18W probably damaging Het
Zfp712 T A 13: 67,042,050 K138* probably null Het
Zfp867 A T 11: 59,463,591 V304D probably damaging Het
Zfp870 T C 17: 32,884,053 T102A possibly damaging Het
Zmym5 G A 14: 56,797,753 S286L possibly damaging Het
Other mutations in Aaas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Aaas APN 15 102339374 missense possibly damaging 0.77
IGL01620:Aaas APN 15 102339950 missense probably damaging 1.00
IGL02337:Aaas APN 15 102339227 missense probably benign 0.01
IGL02608:Aaas APN 15 102339192 missense probably benign 0.00
IGL03024:Aaas APN 15 102350491 splice site probably benign
IGL03217:Aaas APN 15 102349995 missense probably damaging 1.00
IGL03273:Aaas APN 15 102349995 missense probably damaging 1.00
Shrinker UTSW 15 102346676 critical splice donor site probably null
R1545:Aaas UTSW 15 102339206 missense probably damaging 1.00
R1546:Aaas UTSW 15 102346718 missense probably benign 0.00
R1957:Aaas UTSW 15 102338633 unclassified probably benign
R1996:Aaas UTSW 15 102340059 missense probably benign 0.10
R3079:Aaas UTSW 15 102340444 missense probably damaging 0.99
R3715:Aaas UTSW 15 102340336 missense probably benign 0.01
R5427:Aaas UTSW 15 102339950 missense possibly damaging 0.94
R5586:Aaas UTSW 15 102346676 critical splice donor site probably null
R5620:Aaas UTSW 15 102338391 missense probably benign 0.00
R5969:Aaas UTSW 15 102350564 missense probably damaging 1.00
R6763:Aaas UTSW 15 102340022 missense probably null
R8230:Aaas UTSW 15 102338469 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGATTACAGCAGGGCCTTC -3'
(R):5'- GAGTTTCAGCTGAGCTCTGC -3'

Sequencing Primer
(F):5'- TGGACTGGCCGGGAAGTG -3'
(R):5'- GCCAGCTATCACTGTGATCTTAAAC -3'
Posted On2014-08-25