Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Map3k4'

224460

Institutional Source

Beutler Lab

Gene Symbol

Map3k4

Ensembl Gene

ENSMUSG00000014426

Gene Name

mitogen-activated protein kinase kinase kinase 4

Synonyms

D17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12227621-12318660 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 12254995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000086459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089058]

AlphaFold

O08648

Predicted Effect

probably null
Transcript: ENSMUST00000089058

SMART Domains

Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	27	43	N/A	INTRINSIC
low complexity region	215	235	N/A	INTRINSIC
low complexity region	432	462	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
S_TKc	1332	1590	1.41e-91	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Map3k4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Map3k4	APN	17	12232990	missense	probably damaging	1.00
IGL01124:Map3k4	APN	17	12255200	missense	probably benign	0.01
IGL01125:Map3k4	APN	17	12271962	missense	probably damaging	0.96
IGL01585:Map3k4	APN	17	12248959	missense	probably damaging	1.00
IGL02194:Map3k4	APN	17	12248995	missense	probably benign	0.30
IGL02194:Map3k4	APN	17	12263928	missense	probably damaging	1.00
IGL02292:Map3k4	APN	17	12235158	missense	possibly damaging	0.77
IGL02326:Map3k4	APN	17	12249010	missense	probably damaging	1.00
IGL02388:Map3k4	APN	17	12271610	missense	probably damaging	0.99
IGL02621:Map3k4	APN	17	12264013	missense	probably damaging	1.00
IGL02668:Map3k4	APN	17	12235953	missense	possibly damaging	0.85
IGL02850:Map3k4	APN	17	12271914	missense	probably damaging	1.00
IGL02939:Map3k4	APN	17	12272149	missense	probably damaging	1.00
IGL03148:Map3k4	APN	17	12238158	missense	probably benign	0.01
IGL03238:Map3k4	APN	17	12271158	missense	probably benign	0.10
ANU74:Map3k4	UTSW	17	12232976	missense	probably damaging	1.00
R0012:Map3k4	UTSW	17	12238189	missense	probably damaging	1.00
R0012:Map3k4	UTSW	17	12238189	missense	probably damaging	1.00
R0128:Map3k4	UTSW	17	12248063	missense	probably damaging	0.99
R0183:Map3k4	UTSW	17	12235128	missense	probably damaging	1.00
R0309:Map3k4	UTSW	17	12271015	frame shift	probably null
R0355:Map3k4	UTSW	17	12254171	missense	probably damaging	1.00
R0367:Map3k4	UTSW	17	12258041	splice site	probably benign
R1103:Map3k4	UTSW	17	12237063	splice site	probably null
R1446:Map3k4	UTSW	17	12256794	nonsense	probably null
R1542:Map3k4	UTSW	17	12235906	missense	probably damaging	0.97
R1713:Map3k4	UTSW	17	12249571	missense	probably benign	0.39
R1777:Map3k4	UTSW	17	12271730	missense	possibly damaging	0.82
R1797:Map3k4	UTSW	17	12264019	missense	probably benign	0.30
R2042:Map3k4	UTSW	17	12277983	missense	probably damaging	0.99
R2878:Map3k4	UTSW	17	12264067	missense	probably benign	0.00
R2939:Map3k4	UTSW	17	12261270	missense	probably damaging	0.98
R2940:Map3k4	UTSW	17	12261270	missense	probably damaging	0.98
R3405:Map3k4	UTSW	17	12256781	missense	probably damaging	1.00
R3930:Map3k4	UTSW	17	12235993	missense	possibly damaging	0.83
R4291:Map3k4	UTSW	17	12255260	missense	probably benign	0.08
R4410:Map3k4	UTSW	17	12248998	missense	probably damaging	1.00
R4632:Map3k4	UTSW	17	12232504	missense	probably damaging	1.00
R4641:Map3k4	UTSW	17	12264045	missense	probably damaging	1.00
R4726:Map3k4	UTSW	17	12232964	missense	possibly damaging	0.89
R4730:Map3k4	UTSW	17	12248974	missense	probably damaging	0.99
R4832:Map3k4	UTSW	17	12271780	missense	probably damaging	1.00
R4896:Map3k4	UTSW	17	12272019	missense	possibly damaging	0.65
R4934:Map3k4	UTSW	17	12271900	missense	probably damaging	1.00
R4971:Map3k4	UTSW	17	12249495	critical splice donor site	probably null
R4980:Map3k4	UTSW	17	12272071	missense	probably damaging	1.00
R5211:Map3k4	UTSW	17	12232434	missense	possibly damaging	0.88
R5337:Map3k4	UTSW	17	12271610	missense	probably damaging	0.99
R5356:Map3k4	UTSW	17	12247308	missense	possibly damaging	0.87
R5550:Map3k4	UTSW	17	12243558	nonsense	probably null
R5824:Map3k4	UTSW	17	12229639	missense	probably damaging	1.00
R5890:Map3k4	UTSW	17	12271416	missense	probably damaging	1.00
R6285:Map3k4	UTSW	17	12264058	missense	probably damaging	1.00
R6380:Map3k4	UTSW	17	12272067	missense	possibly damaging	0.56
R6383:Map3k4	UTSW	17	12249583	missense	possibly damaging	0.82
R6571:Map3k4	UTSW	17	12242692	missense	possibly damaging	0.80
R6584:Map3k4	UTSW	17	12260491	missense	probably damaging	1.00
R6616:Map3k4	UTSW	17	12271344	missense	probably damaging	1.00
R6644:Map3k4	UTSW	17	12232410	critical splice donor site	probably null
R6909:Map3k4	UTSW	17	12270985	missense	probably damaging	1.00
R6947:Map3k4	UTSW	17	12260569	nonsense	probably null
R6970:Map3k4	UTSW	17	12248916	missense	probably damaging	1.00
R7120:Map3k4	UTSW	17	12271467	missense	probably damaging	1.00
R7253:Map3k4	UTSW	17	12272068	missense	probably benign	0.00
R7267:Map3k4	UTSW	17	12271649	nonsense	probably null
R7322:Map3k4	UTSW	17	12270946	missense	probably damaging	1.00
R7522:Map3k4	UTSW	17	12261332	missense	probably benign	0.39
R7554:Map3k4	UTSW	17	12232413	missense	probably damaging	1.00
R7554:Map3k4	UTSW	17	12232414	nonsense	probably null
R7681:Map3k4	UTSW	17	12318543	missense	unknown
R7734:Map3k4	UTSW	17	12264111	missense	probably damaging	1.00
R7842:Map3k4	UTSW	17	12271143	missense	possibly damaging	0.54
R8013:Map3k4	UTSW	17	12271031	nonsense	probably null
R8014:Map3k4	UTSW	17	12271031	nonsense	probably null
R8235:Map3k4	UTSW	17	12240081	splice site	probably null
R8294:Map3k4	UTSW	17	12318613	missense	unknown
R8528:Map3k4	UTSW	17	12232934	missense	probably damaging	1.00
R8858:Map3k4	UTSW	17	12271872	missense	probably damaging	1.00
R8924:Map3k4	UTSW	17	12271546	missense	probably benign	0.00
R9063:Map3k4	UTSW	17	12263991	missense	probably damaging	1.00
R9224:Map3k4	UTSW	17	12238086	missense	probably damaging	0.99
R9446:Map3k4	UTSW	17	12232488	missense	probably damaging	1.00
R9486:Map3k4	UTSW	17	12270973	missense	probably damaging	1.00
R9488:Map3k4	UTSW	17	12270973	missense	probably damaging	1.00
R9591:Map3k4	UTSW	17	12235908	missense	possibly damaging	0.91
R9617:Map3k4	UTSW	17	12257984	missense	possibly damaging	0.67
R9722:Map3k4	UTSW	17	12271636	missense	probably benign	0.01
X0067:Map3k4	UTSW	17	12264094	missense	probably benign	0.03
Z1177:Map3k4	UTSW	17	12271697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGACTGTGAGCGCAAGAG -3'
(R):5'- CAATGCTGCCACAGGAAAG -3'

Sequencing Primer
(F):5'- CTGTGAGCGCAAGAGAAAGAAC -3'
(R):5'- TGCCACAGGAAAGGACTGCTC -3'

Posted On

2014-08-25